RegulonDB RegulonDB 10.9: Gene Sequence
garL gene sequence


Size: 771        A: 183  T: 180  G: 202  C: 206

Fasta

 

>garL E. coli K12. Version NC_000913.3 GI:556503834
atgaataacgatgttttcccgaataaattcaaagccgcactggctgcgaaacaggtacaa
attggttgctggtcagcactctctaacccgattagcactgaagttcttggtttggctggg
tttgactggctggtgctggatggcgaacatgcgccaaacgatatctccacgtttattccg
cagttaatggccttgaaaggcagcgccagcgcgccagtagtgcgagtgccgaccaacgag
ccggtaattattaagcgtcttctggatatcggtttctataacttcctgattccttttgta
gaaacaaaagaggaagcagagctggcggtggcatcaacccgttacccaccggaaggcatt
cgcggcgtctccgtttctcaccgcgccaatatgtttggcaccgtggcggattatttcgct
cagtcgaacaagaacatcactattctggtccagatagaaagtcagcagggcgtagataac
gtcgatgccattgccgctaccgaaggcgtagacggcatcttcgtcggccccagcgatctg
gccgcggcattaggccatctcggcaatgcatcacacccggatgtacaaaaagcaattcag
cacatttttaaccgtgccagcgcgcacggcaaacccagcggtatcctcgcgccggtcgaa
gccgatgcgcgtcgttatctggaatggggcgcgacgtttgtggctgtcggcagcgatctc
ggcgtcttccgctctgccactcagaaactggctgatacctttaaaaaataa
              
                            

Download fasta file
RegulonDB