RegulonDB RegulonDB 10.10: Gene Sequence
aceB gene sequence


Size: 1602        A: 416  T: 357  G: 425  C: 404

Fasta

 

>aceB E. coli K12. Version NC_000913.3 GI:556503834
atgactgaacaggcaacaacaaccgatgaactggctttcacaaggccgtatggcgagcag
gagaagcaaattcttactgccgaagcggtagaatttctgactgagctggtgacgcatttt
acgccacaacgcaataaacttctggcagcgcgcattcagcagcagcaagatattgataac
ggaacgttgcctgattttatttcggaaacagcttccattcgcgatgctgattggaaaatt
cgcgggattcctgcggacttagaagaccgccgcgtagagataactggcccggtagagcgc
aagatggtgatcaacgcgctcaacgccaatgtgaaagtctttatggccgatttcgaagat
tcactggcaccagactggaacaaagtgatcgacgggcaaattaacctgcgtgatgcggtt
aacggcaccatcagttacaccaatgaagcaggcaaaatttaccagctcaagcccaatcca
gcggttttgatttgtcgggtacgcggtctgcacttgccggaaaaacatgtcacctggcgt
ggtgaggcaatccccggcagcctgtttgattttgcgctctatttcttccacaactatcag
gcactgttggcaaagggcagtggtccctatttctatctgccgaaaacccagtcctggcag
gaagcggcctggtggagcgaagtcttcagctatgcagaagatcgctttaatctgccgcgc
ggcaccatcaaggcgacgttgctgattgaaacgctgcccgccgtgttccagatggatgaa
atccttcacgcgctgcgtgaccatattgttggtctgaactgcggtcgttgggattacatc
ttcagctatatcaaaacgttgaaaaactatcccgatcgcgtcctgccagacagacaggca
gtgacgatggataaaccattcctgaatgcttactcacgcctgttgattaaaacctgccat
aaacgcggtgcttttgcgatgggcggcatggcggcgtttattccgagcaaagatgaagag
cacaataaccaggtgctcaacaaagtaaaagcggataaatcgctggaagccaataacggt
cacgatggcacatggatcgctcacccaggccttgcggacacggcaatggcggtattcaac
gacattctcggctcccgtaaaaatcagcttgaagtgatgcgcgaacaagacgcgccgatt
actgccgatcagctgctggcaccttgtgatggtgaacgcaccgaagaaggtatgcgcgcc
aacattcgcgtggctgtgcagtacatcgaagcgtggatctctggcaacggctgtgtgccg
atttatggcctgatggaagatgcggcgacggctgaaatttcccgtacctcgatctggcag
tggatccatcatcaaaaaacgttgagcaatggcaaaccggtgaccaaagccttgttccgc
cagatgctgggcgaagagatgaaagtcattgccagcgaactgggcgaagaacgtttctcc
caggggcgttttgacgatgccgcacgcttgatggaacagatcaccacttccgatgagtta
attgatttcctgaccctgccaggctaccgcctgttagcgtaa
              
                            

Download fasta file
RegulonDB