RegulonDB RegulonDB 10.9: Gene Sequence
aceF gene sequence


Size: 1893        A: 477  T: 381  G: 566  C: 469

Fasta

 

>aceF E. coli K12. Version NC_000913.3 GI:556503834
atggctatcgaaatcaaagtaccggacatcggggctgatgaagttgaaatcaccgagatc
ctggtcaaagtgggcgacaaagttgaagccgaacagtcgctgatcaccgtagaaggcgac
aaagcctctatggaagttccgtctccgcaggcgggtatcgttaaagagatcaaagtctct
gttggcgataaaacccagaccggcgcactgattatgattttcgattccgccgacggtgca
gcagacgctgcacctgctcaggcagaagagaagaaagaagcagctccggcagcagcacca
gcggctgcggcggcaaaagacgttaacgttccggatatcggcagcgacgaagttgaagtg
accgaaatcctggtgaaagttggcgataaagttgaagctgaacagtcgctgatcaccgta
gaaggcgacaaggcttctatggaagttccggctccgtttgctggcaccgtgaaagagatc
aaagtgaacgtgggtgacaaagtgtctaccggctcgctgattatggtcttcgaagtcgcg
ggtgaagcaggcgcggcagctccggccgctaaacaggaagcagctccggcagcggcccct
gcaccagcggctggcgtgaaagaagttaacgttccggatatcggcggtgacgaagttgaa
gtgactgaagtgatggtgaaagtgggcgacaaagttgccgctgaacagtcactgatcacc
gtagaaggcgacaaagcttctatggaagttccggcgccgtttgcaggcgtcgtgaaggaa
ctgaaagtcaacgttggcgataaagtgaaaactggctcgctgattatgatcttcgaagtt
gaaggcgcagcgcctgcggcagctcctgcgaaacaggaagcggcagcgccggcaccggca
gcaaaagctgaagccccggcagcagcaccagctgcgaaagcggaaggcaaatctgaattt
gctgaaaacgacgcttatgttcacgcgactccgctgatccgccgtctggcacgcgagttt
ggtgttaaccttgcgaaagtgaagggcactggccgtaaaggtcgtatcctgcgcgaagac
gttcaggcttacgtgaaagaagctatcaaacgtgcagaagcagctccggcagcgactggc
ggtggtatccctggcatgctgccgtggccgaaggtggacttcagcaagtttggtgaaatc
gaagaagtggaactgggccgcatccagaaaatctctggtgcgaacctgagccgtaactgg
gtaatgatcccgcatgttactcacttcgacaaaaccgatatcaccgagttggaagcgttc
cgtaaacagcagaacgaagaagcggcgaaacgtaagctggatgtgaagatcaccccggtt
gtcttcatcatgaaagccgttgctgcagctcttgagcagatgcctcgcttcaatagttcg
ctgtcggaagacggtcagcgtctgaccctgaagaaatacatcaacatcggtgtggcggtg
gataccccgaacggtctggttgttccggtattcaaagacgtcaacaagaaaggcatcatc
gagctgtctcgcgagctgatgactatttctaagaaagcgcgtgacggtaagctgactgcg
ggcgaaatgcagggcggttgcttcaccatctccagcatcggcggcctgggtactacccac
ttcgcgccgattgtgaacgcgccggaagtggctatcctcggcgtttccaagtccgcgatg
gagccggtgtggaatggtaaagagttcgtgccgcgtctgatgctgccgatttctctctcc
ttcgaccaccgcgtgatcgacggtgctgatggtgcccgtttcattaccatcattaacaac
acgctgtctgacattcgccgtctggtgatgtaa
              
                            

Download fasta file
RegulonDB