RegulonDB RegulonDB 10.10: Gene Sequence
aceK gene sequence


Size: 1737        A: 389  T: 431  G: 467  C: 450

Fasta

 

>aceK E. coli K12. Version NC_000913.3 GI:556503834
atgccgcgtggcctggaattattgattgctcaaaccattttgcaaggcttcgatgctcag
tatggtcgattcctcgaagtgacctccggtgcgcagcagcgtttcgaacaggccgactgg
catgctgtccagcaggcgatgaaaaaccgtatccatctttacgatcatcacgttggtctg
gtcgtggagcaactgcgctgcattactaacggccaaagtacggacgcggcatttttacta
cgtgttaaagagcattacacccggctgttgccggattacccgcgcttcgagattgcggag
agcttttttaactccgtgtactgtcggttatttgaccaccgctcgcttactcccgagcgg
ctttttatctttagctctcagccagagcgccgctttcgtaccattccccgcccgctggcg
aaagactttcaccccgatcacggctgggaatctctactgatgcgcgttatcagcgaccta
ccgctgcgcctgcgctggcagaataaaagccgtgacatccattacattattcgccatctg
acggaaacgctggggacagacaacctcgcggaaagtcatttacaggtggcgaacgaactg
ttttaccgcaataaagccgcctggctggtaggcaaactgatcacaccttccggcacattg
ccatttttgctgccgatccaccagacggacgacggcgagttatttattgatacctgcctg
acgacgaccgccgaagcgagcattgtttttggctttgcgcgttcttattttatggtttat
gcgccgctgcccgcagcgctggtcgagtggctacgggaaattctgccaggtaaaaccacc
gctgaattgtatatggctatcggctgccagaagcacgccaaaaccgaaagctaccgcgaa
tatctcgtttatctacagggctgtaatgagcagttcattgaagcgccgggtattcgtgga
atggtgatgttggtgtttacgctgccgggctttgatcgggtattcaaagtcatcaaagac
aggttcgcgccgcagaaagagatgtctgccgctcacgttcgtgcctgctatcaactggtg
aaagagcacgatcgcgtgggccgaatggcggacacccaggagtttgaaaactttgtgctg
gagaagcggcatatttccccggcattaatggaattactgcttcaggaagcagcggaaaaa
atcaccgatctcggcgaacaaattgtgattcgccatctttatattgagcggcggatggtg
ccgctcaatatctggctggaacaagtggaaggtcagcagttgcgcgacgccattgaagaa
tacggtaacgctattcgccagcttgccgctgctaacattttccctggcgacatgctgttt
aaaaacttcggtgtcacccgtcacgggcgtgtggttttttatgattacgatgaaatttgc
tacatgacggaagtgaatttccgcgacatcccgccgccgcgctatccggaagacgaactt
gccagcgaaccgtggtacagcgtctcgccgggcgatgttttcccggaagagtttcgccac
tggctatgcgccgacccgcgtattggtccgctgtttgaagagatgcacgccgacctgttc
cgcgctgattactggcgcgcactacaaaaccgcatacgtgaagggcatgtggaagatgtt
tatgcgtatcggcgcaggcaaagatttagcgtacggtatggggagatgcttttttga
              
                            

Download fasta file
RegulonDB