RegulonDB RegulonDB 10.9: Gene Sequence
pflA gene sequence


Size: 741        A: 189  T: 179  G: 197  C: 176

Fasta

 

>pflA E. coli K12. Version NC_000913.3 GI:556503834
atgtcagttattggtcgcattcactcctttgaatcctgtggaaccgtagacggcccaggt
attcgctttatcacctttttccagggctgcctgatgcgctgcctgtattgtcataaccgc
gacacctgggacacgcatggcggtaaagaagttaccgttgaagatttgatgaaggaagtg
gtgacctatcgccactttatgaacgcttccggcggcggcgttaccgcatccggcggtgaa
gcaatcctgcaagctgagtttgttcgtgactggttccgcgcctgcaaaaaagaaggcatt
catacctgtctggacaccaacggttttgttcgtcgttacgatccggtgattgatgaactg
ctggaagtaaccgacctggtaatgctcgatctcaaacagatgaacgacgagatccaccaa
aatctggttggagtttccaaccaccgcacgctggagttcgctaaatatctggcgaacaaa
aatgtgaaggtgtggatccgctacgttgttgtcccaggctggtctgacgatgacgattca
gcgcatcgcctcggtgaatttacccgtgatatgggcaacgttgagaaaatcgagcttctc
ccctaccacgagctgggcaaacacaaatgggtggcaatgggtgaagagtacaaactcgac
ggtgttaaaccaccgaagaaagagaccatggaacgcgtgaaaggcattcttgagcagtac
ggtcataaggtaatgttctaa
              
                            

Download fasta file
RegulonDB