RegulonDB RegulonDB 10.8: Gene Sequence
adhE gene sequence


Size: 2676        A: 680  T: 641  G: 665  C: 690

Fasta

 

>adhE E. coli K12. Version NC_000913.3 GI:556503834
atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtaaaaaaagcccag
cgtgaatatgccagtttcactcaagagcaagtagacaaaatcttccgcgccgccgctctg
gctgctgcagatgctcgaatcccactcgcgaaaatggccgttgccgaatccggcatgggt
atcgtcgaagataaagtgatcaaaaaccactttgcttctgaatatatctacaacgcctat
aaagatgaaaaaacctgtggtgttctgtctgaagacgacacttttggtaccatcactatc
gctgaaccaatcggtattatttgcggtatcgttccgaccactaacccgacttcaactgct
atcttcaaatcgctgatcagtctgaagacccgtaacgccattatcttctccccgcacccg
cgtgcaaaagatgccaccaacaaagcggctgatatcgttctgcaggctgctatcgctgcc
ggtgctccgaaagatctgatcggctggatcgatcaaccttctgttgaactgtctaacgca
ctgatgcaccacccagacatcaacctgatcctcgcgactggtggtccgggcatggttaaa
gccgcatacagctccggtaaaccagctatcggtgtaggcgcgggcaacactccagttgtt
atcgatgaaactgctgatatcaaacgtgcagttgcatctgtactgatgtccaaaaccttc
gacaacggcgtaatctgtgcttctgaacagtctgttgttgttgttgactctgtttatgac
gctgtacgtgaacgttttgcaacccacggcggctatctgttgcagggtaaagagctgaaa
gctgttcaggatgttatcctgaaaaacggtgcgctgaacgcggctatcgttggtcagcca
gcctataaaattgctgaactggcaggcttctctgtaccagaaaacaccaagattctgatc
ggtgaagtgaccgttgttgatgaaagcgaaccgttcgcacatgaaaaactgtccccgact
ctggcaatgtaccgcgctaaagatttcgaagacgcggtagaaaaagcagagaaactggtt
gctatgggcggtatcggtcatacctcttgcctgtacactgaccaggataaccaaccggct
cgcgtttcttacttcggtcagaaaatgaaaacggcgcgtatcctgattaacaccccagcg
tctcagggtggtatcggtgacctgtataacttcaaactcgcaccttccctgactctgggt
tgtggttcttggggtggtaactccatctctgaaaacgttggtccgaaacacctgatcaac
aagaaaaccgttgctaagcgagctgaaaacatgttgtggcacaaacttccgaaatctatc
tacttccgccgtggctccctgccaatcgcgctggatgaagtgattactgatggccacaaa
cgtgcgctcatcgtgactgaccgcttcctgttcaacaatggttatgctgatcagatcact
tccgtactgaaagcagcaggcgttgaaactgaagtcttcttcgaagtagaagcggacccg
accctgagcatcgttcgtaaaggtgcagaactggcaaactccttcaaaccagacgtgatt
atcgcgctgggtggtggttccccgatggacgccgcgaagatcatgtgggttatgtacgaa
catccggaaactcacttcgaagagctggcgctgcgctttatggatatccgtaaacgtatc
tacaagttcccgaaaatgggcgtgaaagcgaaaatgatcgctgtcaccaccacttctggt
acaggttctgaagtcactccgtttgcggttgtaactgacgacgctactggtcagaaatat
ccgctggcagactatgcgctgactccggatatggcgattgtcgacgccaacctggttatg
gacatgccgaagtccctgtgtgctttcggtggtctggacgcagtaactcacgccatggaa
gcttatgtttctgtactggcatctgagttctctgatggtcaggctctgcaggcactgaaa
ctgctgaaagaatatctgccagcgtcctaccacgaagggtctaaaaatccggtagcgcgt
gaacgtgttcacagtgcagcgactatcgcgggtatcgcgtttgcgaacgccttcctgggt
gtatgtcactcaatggcgcacaaactgggttcccagttccatattccgcacggtctggca
aacgccctgctgatttgtaacgttattcgctacaatgcgaacgacaacccgaccaagcag
actgcattcagccagtatgaccgtccgcaggctcgccgtcgttatgctgaaattgccgac
cacttgggtctgagcgcaccgggcgaccgtactgctgctaagatcgagaaactgctggca
tggctggaaacgctgaaagctgaactgggtattccgaaatctatccgtgaagctggcgtt
caggaagcagacttcctggcgaacgtggataaactgtctgaagatgcattcgatgaccag
tgcaccggcgctaacccgcgttacccgctgatctccgagctgaaacagattctgctggat
acctactacggtcgtgattatgtagaaggtgaaactgcagcgaagaaagaagctgctccg
gctaaagctgagaaaaaagcgaaaaaatccgcttaa
              
                            

Download fasta file
RegulonDB