RegulonDB RegulonDB 10.9: Gene Sequence
amn gene sequence


Size: 1455        A: 351  T: 373  G: 345  C: 386

Fasta

 

>amn E. coli K12. Version NC_000913.3 GI:556503834
atgaataataagggctccggtctgaccccagctcaggcactggataaactcgacgcgctg
tatgagcaatctgtagtcgcattacgcaacgccattggcaactatattacaagtggcgaa
ttacctgatgaaaacgcccgcaaacaaggtctttttgtctatccatcactgaccgtaacc
tgggacggtagcacaaccaatccccccaaaacgcgcgcatttggtcgctttacccacgca
ggcagctacaccaccacgattactcgccctactctctttcgttcgtatcttaatgaacaa
cttacgttgctgtatcaggattatggtgcgcatatctcagtgcaaccctcgcagcatgaa
atcccttatccttatgtcatcgatggctctgaattgacacttgatcgctcaatgagcgct
gggttaactcgctacttcccgacaacagaactggcgcaaattggcgatgaaactgcagac
ggcatttatcatccaactgaattctccccgctatcgcattttgatgcgcgccgcgtcgat
ttttccctcgcacggttgcgccattataccggtacgccagttgaacattttcagccgttc
gtcttgtttaccaactacacacgttatgtggatgaattcgttcgttggggatgcagccag
atcctcgatcctgatagtccctacattgccctttcttgtgctggcgggaactggatcacc
gccgaaaccgaagcgccagaagaagccatttccgaccttgcatggaaaaaacatcagatg
ccagcatggcatttaattaccgccgatggtcagggtattactctggtgaatattggcgtg
ggaccgtcaaatgctaaaaccatctgcgatcatctggcagtgctacgcccggatgtctgg
ttgatgattggtcactgtggcggattacgtgaaagtcaggccattggcgattatgtactt
gcacacgcttatttacgcgatgaccacgttcttgatgcggttctgccgcccgatattcct
attccgagcattgctgaagtgcaacgtgcgctttatgacgccaccaagctggtgagcggc
aggcccggtgaggaagtcaaacagcggctacgtactggtactgtggtaaccacagatgac
aggaactgggaattacgttactcagcttctgcacttcgttttaacttaagccgggccgta
gcaattgatatggaaagtgcaaccattgccgcgcaaggatatcgtttccgcgtgccatac
gggacactactgtgtgtttcagataaaccgttgcatggcgagattaaacttcccggccag
gctaaccgtttttatgaaggcgctatttccgaacatctgcaaattggcattcgggcgatc
gatttgctgcgcgcagaaggcgaccgactgcattcgcgtaaattacgaacctttaatgag
ccgccgttccgataa
              
                            

Download fasta file
RegulonDB