RegulonDB RegulonDB 10.10: Gene Sequence
ampC gene sequence


Size: 1134        A: 308  T: 257  G: 282  C: 287

Fasta

 

>ampC E. coli K12. Version NC_000913.3 GI:556503834
atgttcaaaacgacgctctgcgccttattaattaccgcctcttgctccacatttgctgcc
cctcaacaaatcaacgatattgtgcatcgcacaattaccccgcttatagagcaacaaaag
atcccgggtatggcggtggcggtaatttatcagggtaaaccttattactttacctggggc
tatgcggacatcgccaaaaagcagcccgtcacacagcaaacgttgtttgagttaggttcg
gtcagcaaaacatttactggcgtgcttggtggcgacgctattgctcgaggggaaatcaag
ttaagcgatcccacaacaaaatactggcctgaacttaccgctaaacagtggaatgggatc
acactattacatctcgcaacctacactgctggcggcctgccattgcaggtgccggatgag
gtgaaatcctcaagcgacttgctgcgcttctatcaaaactggcagcctgcatgggctcca
ggaacacaacgtctgtatgccaactccagtatcggtttgttcggcgcactggctgtgaag
ccgtctggtttgagttttgagcaggcgatgcaaactcgtgtcttccagccactcaaactc
aaccatacgtggattaatgtaccgcccgcagaagaaaagaattacgcctggggatatcgc
gaaggtaaggcagtgcatgtttcgcctggggcgttagatgctgaagcttatggtgtgaag
tcgaccattgaagatatggcccgctgggtgcaaagcaatttaaaaccccttgatatcaat
gagaaaacgcttcaacaagggatacaactggcacaatctcgctactggcaaaccggcgat
atgtatcagggcctgggctgggaaatgctggactggccggtaaatcctgacagcatcatt
aacggcagtgacaataaaattgcactggcagcacgccccgtaaaagcgattacgccccca
actcctgcagtacgcgcatcatgggtacataaaacaggggcgaccggcggatttggtagc
tatgtcgcgtttattccagaaaaagagctgggtatcgtgatgctggcaaacaaaaactat
cccaatccagcgagagtcgacgccgcctggcagattcttaacgctctacagtaa
              
                            

Download fasta file
RegulonDB