RegulonDB RegulonDB 10.9: Gene Sequence
ampD gene sequence


Size: 552        A: 114  T: 141  G: 157  C: 140

Fasta

 

>ampD E. coli K12. Version NC_000913.3 GI:556503834
atgttgttagaacaggggtggctggttggcgcgcgccgcgttccctcaccacattacgat
tgccgcccggatgacgaaacacccaccctgctggtggtgcacaatattagcctgccgcca
ggcgagtttggcggtccgtggatcgacgcattattcactggaactattgatccgcaggca
catcctttctttgctgagatcgcccatttgcgcgtctccgctcactgtttgattcgccgt
gatggtgaaatagtccagtatgttcctttcgataaacgtgcatggcatgcgggagtctct
cagtatcaggggcgcgaacgctgcaatgatttttctattgggattgagcttgaaggcacc
gatacgctggcgtataccgatgcgcagtatcaacagcttgcggcggttacgcgggcactg
attgattgctatccggatatcgctaaaaacatgacgggccattgtgatattgcgccggat
cggaaaaccgatcccggtcctgcatttgattgggcacggtttcgtgtgctggtcagcaag
gagacaacatga
              
                            

Download fasta file
RegulonDB