RegulonDB RegulonDB 10.9: Gene Sequence
ampE gene sequence


Size: 855        A: 153  T: 257  G: 256  C: 189

Fasta

 

>ampE E. coli K12. Version NC_000913.3 GI:556503834
atgacgctatttacaaccttactggtgttaattttcgagcgcctgtttaagttgggcgag
cactggcagcttgatcatcgtcttgaagcgttctttcggcgggtgaaacatttttctctc
gggcgcacgttaggcatgaccattattgcgatgggcgtgacttttttactgttacgcgca
ttgcagggagtattgttcaacgttcccacgctactggtgtggctgctgattggtttgctg
tgtattggcgcaggtaaagttcgtcttcattatcatgcttatctgacagctgcttcacgt
aatgatagccatgcccgtgccacgatggctggcgaactcaccatgattcacggcgtcccg
gcaggctgcgacgaacgtgagtatttgcgtgagctgcaaaatgcattgctgtggattaac
tttcgtttttatcttgcaccgctgttctggctgattgtggggggaacctggggacccgtt
acgctgatggggtatgcgtttttgcgtgcatggcaatactggctggcgcgatatcagacg
ccgcatcatcgtttacagtccggcattgatgccgtgcttcatgtactggattgggtgccg
gttcgtcttgcgggtgtggtatatgccttgatcggtcatggtgagaaagcgttaccggcc
tggtttgcttcgctgggtgatttccatacttcgcagtatcaggtgttaacgcgtctggcg
cagttctctctggcgcgtgaaccgcatgtcgataaggtggagacgccgaaggcagcggtt
tcaatggcgaagaaaacctcgttcgtggtcgtggtggtgattgcactactgacgatttac
ggggcgttggtgtaa
              
                            

Download fasta file
RegulonDB