RegulonDB RegulonDB 10.9: Gene Sequence
ansA gene sequence


Size: 1017        A: 257  T: 240  G: 252  C: 268

Fasta

 

>ansA E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaagaaatcaatttacgttgcctacacgggcgggaccatcgggatgcagcgttcc
gagcagggttatataccggtgtcaggtcatctacaacgccaactggcgctgatgccggaa
ttccatcgcccggagatgccagatttcaccattcatgaatatacgccgctgatggattct
tcagatatgacgccggaagactggcagcatattgctgaagatattaaagcgcactatgac
gactatgatggttttgtcattctgcacggcaccgacacgatggcgtataccgcctctgcg
ctgtcgttcatgctcgagaatctcggtaaaccggtcattgtgacagggtcacaaatcccg
ctggctgagttacgctctgacggacaaattaatctgctgaatgcgttgtacgttgcggcg
aattatccgatcaacgaagtaacgctctttttcaataaccgattgtatcgcggcaaccgc
actaccaaagcccatgccgatggttttgatgcgtttgcctctccaaaccttcctccgtta
ctggaagcaggtatccatattcgtcgtttgaatacgccacccgccccgcacggtgaaggg
gaattaatcgttcatccaatcaccccacaaccaattggcgtagtgacgatttatccaggg
atttctgctgacgtcgtgcgcaattttctgcgccaaccggtgaaagcattgattctgcgc
tcctatggcgtgggtaatgcgccacaaaacaaagccttcctgcaggaattacaagaagcc
agcgatcgcggtattgtggtggtcaacctgacacaatgtatgtccggtaaagtgaacatg
ggtggttatgccaccggtaacgccctcgcccatgccggcgtaattggcggtgcagatatg
actgtagaagccacgctaaccaaactgcattacctgcttagccaggaactggatactgaa
accattcgcaaggccatgagccaaaacctgcgcggcgaactgacgccggatgattaa
              
                            

Download fasta file
RegulonDB