RegulonDB RegulonDB 10.9: Gene Sequence
apaH gene sequence


Size: 843        A: 185  T: 188  G: 252  C: 218

Fasta

 

>apaH E. coli K12. Version NC_000913.3 GI:556503834
atggcgacataccttattggcgacgttcatggttgttacgatgaactgatcgcattgctg
cataaagtagaatttacccctgggaaagataccctctggctgacgggcgatctggtcgcg
cgcgggccgggttcgctggatgttctgcgctatgtgaaatccttaggcgacagcgtacgt
ctggtgctgggcaatcacgatctgcatctgctggcggtatttgccgggatcagccgcaat
aaaccgaaagatcgcctgacaccgctgctggaagcgccggatgccgacgagctgcttaac
tggctgcggcgccagcctctgctgcaaatcgacgaagagaaaaagctggtgatggcccac
gcagggatcacgccgcagtgggatctgcagaccgccaaagagtgcgcacgcgatgtagaa
gcggtgctatcgagtgactcctatcccttctttcttgatgccatgtacggcgatatgcca
aataactggtcaccggaattgcgggggctgggaagactgcgttttatcaccaacgctttt
acccgtatgcgtttttgcttcccgaacggtcaactggatatgtacagcaaagaatcgccg
gaagaggcccctgccccactgaaaccgtggtttgcgattcctggccctgtcgctgaagaa
tacagcatcgcctttggtcactgggcatcgctggagggcaaaggtacgccggaaggtata
tacgcgctggataccggctgctgctggggtggtacattaacctgcctgcgctgggaagat
aaacagtattttgtccagccgtcgaaccggcataaggatttgggcgaagcggcggcgtct
taa
              
                            

Download fasta file
RegulonDB