RegulonDB RegulonDB 10.9: Gene Sequence
appY gene sequence


Size: 750        A: 268  T: 244  G: 129  C: 109

Fasta

 

>appY E. coli K12. Version NC_000913.3 GI:556503834
atggattatgtttgctccgtagttttcatctgtcaatcatttgatttaattataaacagg
agagttatctcgttcaaaaaaaattcattgtttattgtaagcgacaaaattagaagggag
ttaccagtatgcccctctaaactaagaattgttgatatagataagaaaacatgtttatcc
ttttttatcgacgtgaataatgagctgcctggcaaatttactcttgataagaatggctat
attgctgaagaggaacctccattatcgcttgttttttctctgtttgaagggattaaaata
gcagactcacactccctttggttaaaagaaagactatgtatatccttacttgccatgttc
aaaaaacgcgaaagtgtaaattcatttatactaacaaatataaatacatttacctgtaaa
attactggaataatcagttttaatattgagcggcaatggcatttaaaagatattgcggaa
ttgatttatacgagtgaaagtttaataaaaaaaagattaagggatgaaggaacgtcattt
actgaaatattgagagatactaggatgaggtatgcaaaaaaactcataacttcaaactct
tattctatcaatgtcgtagcccagaaatgtggctataacagtacttcatatttcatatgt
gcatttaaagattattatggtgtcacgccatctcattattttgagaaaataatcggcgtc
acagatggaataaacaaaacaattgactga
              
                            

Download fasta file
RegulonDB