RegulonDB RegulonDB 10.9: Gene Sequence
apt gene sequence


Size: 552        A: 131  T: 121  G: 147  C: 153

Fasta

 

>apt E. coli K12. Version NC_000913.3 GI:556503834
atgaccgcgactgcacagcagcttgagtatctcaaaaatagcatcaaaagcattcaggac
tacccaaaacccggcattcttttccgcgatgtcaccagcttactggaagacccgaaagct
tacgctctcagcatcgacttgctggttgagcgttacaaaaatgcgggcattaccaaagtt
gtcggcaccgaagcgcgtggcttcttgtttggcgctccggtagctctgggtctgggcgtt
ggctttgtaccggtccgtaaaccgggcaaactgccgcgtgaaaccatcagtgaaacttac
gacctggaatacggcaccgatcagctggagatccacgttgatgccatcaaaccgggcgac
aaagttctggtggtggacgacctgctggcaaccggcggcactatcgaagcgaccgttaaa
ctgatccgtcgtctgggtggtgaagtggctgacgctgcgttcattatcaacctgttcgat
ctcggcggcgaacagcgtctcgaaaaacagggcattaccagctacagccttgtcccgttc
ccgggccattaa
              
                            

Download fasta file
RegulonDB