RegulonDB RegulonDB 10.9: Gene Sequence
araA gene sequence


Size: 1503        A: 345  T: 324  G: 416  C: 418

Fasta

 

>araA E. coli K12. Version NC_000913.3 GI:556503834
atgacgatttttgataattatgaagtgtggtttgtcattggcagccagcatctgtatggc
ccggaaaccctgcgtcaggtcacccaacatgccgagcacgtcgttaatgcgctgaatacg
gaagcgaaactgccctgcaaactggtgttgaaaccgctgggcaccacgccggatgaaatc
accgctatttgccgcgacgcgaattacgacgatcgttgcgctggtctggtggtgtggctg
cacaccttctccccggccaaaatgtggatcaacggcctgaccatgctcaacaaaccgttg
ctgcaattccacacccagttcaacgcggcgctgccgtgggacagtatcgatatggacttt
atgaacctgaaccagactgcacatggcggtcgcgagttcggcttcattggcgcgcgtatg
cgtcagcaacatgccgtggttaccggtcactggcaggataaacaagcccatgagcgtatc
ggctcctggatgcgtcaggcggtctctaaacaggatacccgtcatctgaaagtctgccga
tttggcgataacatgcgtgaagtggcggtcaccgatggcgataaagttgccgcacagatc
aagttcggtttctccgtcaatacctgggcggttggcgatctggtgcaggtggtgaactcc
atcagcgacggcgatgttaacgcgctggtcgatgagtacgaaagctgctacaccatgacg
cctgccacacaaatccacggcaaaaaacgacagaacgtgctggaagcggcgcgtattgag
ctggggatgaagcgtttcctggaacaaggtggcttccacgcgttcaccaccacctttgaa
gatttgcacggtctgaaacagcttcctggtctggccgtacagcgtctgatgcagcagggt
tacggctttgcgggcgaaggcgactggaaaactgccgccctgcttcgcatcatgaaggtg
atgtcaaccggtctgcagggcggcacctcctttatggaggactacacctatcacttcgag
aaaggtaatgacctggtgctcggctcccatatgctggaagtctgcccgtcgatcgccgca
gaagagaaaccgatcctcgacgttcagcatctcggtattggtggtaaggacgatcctgcc
cgcctgatcttcaatacccaaaccggcccagcgattgtcgccagcttgattgatctcggc
gatcgttaccgtctactggttaactgcatcgacacggtgaaaacaccgcactccctgccg
aaactgccggtggcgaatgcgctgtggaaagcgcaaccggatctgccaactgcttccgaa
gcgtggatcctcgctggtggcgcgcaccataccgtcttcagccatgcactgaacctcaac
gatatgcgccaattcgccgagatgcacgacattgaaatcacggtgattgataacgacaca
cgcctgccagcgtttaaagacgcgctgcgctggaacgaagtgtattacgggtttcgtcgc
taa
              
                            

Download fasta file
RegulonDB