RegulonDB RegulonDB 10.9: Gene Sequence
araD gene sequence


Size: 696        A: 175  T: 136  G: 185  C: 200

Fasta

 

>araD E. coli K12. Version NC_000913.3 GI:556503834
atgttagaagatctcaaacgccaggtattagaagccaacctggcgctgccaaaacacaac
ctggtcacgctcacatggggcaacgtcagcgccgttgatcgcgagcgcggcgtctttgtg
atcaaaccttccggcgtcgattacagcgtcatgaccgctgacgatatggtcgtggttagc
atcgaaaccggtgaagtggttgaaggtacgaaaaagccctcctccgacacgccaactcac
cggctgctctatcaggcattcccctccattggcggcattgtgcatacgcactcgcgccac
gccaccatctgggcgcaggcgggtcagtcgattccagcaaccggcaccacccacgccgac
tatttctacggcaccattccctgcacccgcaaaatgaccgacgcagaaatcaacggcgaa
tatgagtgggaaaccggtaacgtcatcgtagaaacctttgaaaaacagggtatcgatgca
gcgcaaatgcccggcgttctggtccattcccacggcccgtttgcatggggcaaaaatgcc
gaagatgcggtgcataacgccatcgtgctggaagaggtcgcttatatggggatattctgc
cgtcagttagcgccgcagttaccggatatgcagcaaacgctgctggataaacactatctg
cgtaagcatggcgcgaaggcatattacgggcagtaa
              
                            

Download fasta file
RegulonDB