RegulonDB RegulonDB 11.0: Gene Sequence
araE gene sequence


Size: 1419        A: 292  T: 401  G: 411  C: 315

Fasta

 

>araE E. coli K12. Version NC_000913.3 GI:556503834
atggttactatcaatacggaatctgctttaacgccacgttctttgcgggatacgcggcgt
atgaatatgtttgtttcggtagctgctgcggtcgcaggattgttatttggtcttgatatc
ggcgtaatcgccggagcgttgccgttcattaccgatcactttgtgctgaccagtcgtttg
caggaatgggtggttagtagcatgatgctcggtgcagcaattggtgcgctgtttaatggt
tggctgtcgttccgcctggggcgtaaatacagcctgatggcgggggccatcctgtttgta
ctcggttctatagggtccgcttttgcgaccagcgtagagatgttaatcgccgctcgtgtg
gtgctgggcattgctgtcgggatcgcgtcttacaccgctcctctgtatctttctgaaatg
gcaagtgaaaacgttcgcggtaagatgatcagtatgtaccagttgatggtcacactcggc
atcgtgctggcgtttttatccgatacagcgttcagttatagcggtaactggcgcgcaatg
ttgggggttcttgctttaccagcagttctgctgattattctggtagtcttcctgccaaat
agcccgcgctggctggcggaaaaggggcgtcatattgaggcggaagaagtattgcgtatg
ctgcgcgatacgtcggaaaaagcgcgagaagaactcaacgaaattcgtgaaagcctgaag
ttaaaacagggcggttgggcactgtttaagatcaaccgtaacgtccgtcgtgctgtgttt
ctcggtatgttgttgcaggcgatgcagcagtttaccggtatgaacatcatcatgtactac
gcgccgcgtatcttcaaaatggcgggctttacgaccacagaacaacagatgattgcgact
ctggtcgtagggctgacctttatgttcgccacctttattgcggtgtttacggtagataaa
gcagggcgtaaaccggctctgaaaattggtttcagcgtgatggcgttaggcactctggtg
ctgggctattgcctgatgcagtttgataacggtacggcttccagtggcttgtcctggctc
tctgttggcatgacgatgatgtgtattgccggttatgcgatgagcgccgcgccagtggtg
tggatcctgtgctctgaaattcagccgctgaaatgccgcgatttcggtattacctgttcg
accaccacgaactgggtgtcgaatatgattatcggcgcgaccttcctgacactgcttgat
agcattggcgctgccggtacgttctggctctacactgcgctgaacattgcgtttgtgggc
attactttctggctcattccggaaaccaaaaatgtcacgctggaacatatcgaacgcaaa
ctgatggcaggcgagaagttgagaaatatcggcgtctga
              
                            

Download fasta file
RegulonDB