RegulonDB RegulonDB 10.9: Gene Sequence
araG gene sequence


Size: 1515        A: 369  T: 354  G: 423  C: 369

Fasta

 

>araG E. coli K12. Version NC_000913.3 GI:556503834
atgcaacagtctaccccgtatctctcatttcgcggcatcggtaaaacgtttcccggcgtt
aaggcgctgacggatattagttttgactgctatgccggtcaggttcatgcgttgatgggt
gaaaatggcgcaggaaaatcaactctcttaaaaatcctcagcggcaactatgcgccaacc
acgggttctgtagtgattaatgggcaggaaatgtccttttccgacacgaccgcagcactt
aacgcgggcgtggcgattatttaccaggaactgcatctcgtgccggaaatgaccgtcgcg
gaaaacatctatctcggccagctgccgcataaaggcggcattgtgaatcgctcattgctg
aattatgaggcgggtttacaacttaaacatcttggtatggatattgacccggacacgccg
ctgaaatatctctccattggtcagtggcagatggttgaaatcgccaaagcgctggcgcgt
aacgccaaaattatcgcctttgatgagccaaccagctccctctctgcccgtgaaatcgac
aatcttttccgcgttattcgtgaactgcgaaaagaggggcgggtaatcttatacgtttct
caccgtatggaagaaatatttgccctcagcgatgccattactgtctttaaagatggacgt
tatgtcaaaacctttaccgatatgcagcaggttgaccacgacgcgctggtgcaggcgatg
gtcgggcgcgacattggcgatatctacggctggcaaccgcgtagttatggcgaggagcgc
ctacgtcttgatgctgtgaaagcaccaggcgtgcgtacgccaataagtctggcggttcgc
agtggtgaaattgttgggctgtttggtctggtaggggcggggcgtagcgaattaatgaaa
ggcatgtttggcgggacgcaaatcaccgccggtcaggtttatatcgaccaacagccgatc
gatattcgtaaaccgagccacgccattgccgcaggcatgatgctctgcccggaagatcgc
aaagcggaaggcattattcccgtgcactccgttcgcgacaatatcaacatcagtgccaga
cgtaaacatgtgctcggcggttgtgtaatcaacaacggttgggaagaaaacaatgccgat
caccacattcgttcgctcaacatcaaaacgccgggcgcggagcaactgatcatgaatctc
tcaggcggaaatcagcaaaaagccattctgggccgctggttatcggaagagatgaaggtc
attttgctggatgaacctacgcgcggcattgatgttggcgctaagcacgaaatatataac
gtaatttatgcgctggcggcgcagggcgtggcggtgctgtttgcctccagcgacttacct
gaagtcctcggcgttgccgaccggattgtggtgatgcgggaaggtgaaatcgccggtgaa
ttgttacacgagcaggcagatgagcgtcaggcactgagccttgcgatgcctaaagtcagc
caggctgttgcctga
              
                            

Download fasta file
RegulonDB