RegulonDB RegulonDB 10.9: Gene Sequence
araH gene sequence


Size: 987        A: 184  T: 298  G: 275  C: 230

Fasta

 

>araH E. coli K12. Version NC_000913.3 GI:556503834
atgtcttctgtttctacatcggggtctggcgcacctaagtcgtcattcagcttcgggcgt
atctgggatcagtacggcatgctggtggtgtttgcggtgctctttatcgcctgtgccatt
tttgtcccaaattttgccaccttcattaatatgaaagggttgggcctggcaatttccatg
tcggggatggtggcttgtggcatgttgttctgcctcgcttccggtgactttgacctttct
gtcgcctccgtaattgcctgtgcgggtgtcaccacggcggtggttattaacctgactgaa
agcctgtggattggcgtggcagcggggttgttgctgggcgttctctgtggcctggtcaat
ggctttgttatcgccaaactgaaaataaatgctctgatcacgacattggcaacgatgcag
attgttcgaggtctggcgtacatcatttcagacggtaaagcggtcggtatcgaagatgaa
agcttctttgcccttggttacgccaactggttcggtctgcctgcgccaatctggctcacc
gtcgcgtgtctgattatctttggtttgctgctgaataaaaccacctttggtcgtaacacc
ctggcgattggcgggaacgaagaggccgcgcgtctggcgggtgtaccggttgttcgcacc
aaaattattatctttgttctctcaggcctggtatcagcgatagccggaattattctggct
tcacgtatgaccagtgggcagccaatgacgtcgattggttatgagctgattgttatctcc
gcctgcgttttaggtggcgtttctctgaaaggtggcatcggaaaaatctcatatgtggtg
gcgggtatcttaattttaggcaccgtggaaaacgccatgaacctgcttaatatttctcct
ttcgcgcagtacgtggttcgcggcttaatcctgctggcagcggtgatcttcgaccgttac
aagcaaaaagcgaaacgcactgtctga
              
                            

Download fasta file
RegulonDB