RegulonDB RegulonDB 10.10: Gene Sequence
arcA gene sequence


Size: 717        A: 189  T: 162  G: 185  C: 181

Fasta

 

>arcA E. coli K12. Version NC_000913.3 GI:556503834
atgcagaccccgcacattcttatcgttgaagacgagttggtaacacgcaacacgttgaaa
agtattttcgaagcggaaggctatgatgttttcgaagcgacagatggcgcggaaatgcat
cagatcctctctgaatatgacatcaacctggtgatcatggatatcaatctgccgggtaag
aacggtcttctgttagcgcgtgaactgcgcgagcaggcgaatgttgcgttgatgttcctg
actggccgtgacaacgaagtcgataaaattctcggcctcgaaatcggtgcagatgactac
atcaccaaaccgttcaacccgcgtgaactgacgattcgtgcacgcaacctactgtcccgt
accatgaatctgggtactgtcagcgaagaacgtcgtagcgttgaaagctacaagttcaat
ggttgggaactggacatcaacagccgttcgttgatcggccctgatggcgagcagtacaag
ctgccgcgcagcgagttccgcgccatgcttcacttctgtgaaaacccaggcaaaattcag
tcccgtgctgaactgctgaagaaaatgaccggccgtgagctgaaaccgcacgaccgtact
gtagacgtgacgatccgccgtattcgtaaacatttcgaatctacgccggatacgccggaa
atcatcgccaccattcacggtgaaggttatcgcttctgcggtgatctggaagattaa
              
                            

Download fasta file
RegulonDB