RegulonDB RegulonDB 11.1: Gene Sequence
argA gene sequence


Size: 1332        A: 324  T: 308  G: 378  C: 322

Fasta

 

>argA E. coli K12. Version NC_000913.3 GI:556503834
gtggtaaaggaacgtaaaaccgagttggtcgagggattccgccattcggttccctatatc
aatacccaccggggaaaaacgtttgtcatcatgctcggcggtgaagccattgagcatgag
aatttctccagtatcgttaatgatatcgggttgttgcacagcctcggcatccgtctggtg
gtggtctatggcgcacgtccgcagatcgacgcaaatctggctgcgcatcaccacgaaccg
ctgtatcacaagaatatacgtgtgaccgacgccaaaacactggaactggtgaagcaggct
gcgggaacattgcaactggatattactgctcgcctgtcgatgagtctcaataacacgccg
ctgcagggcgcgcatatcaacgtcgtcagtggcaattttattattgcccagccgctgggc
gtcgatgacggcgtggattactgccatagcgggcgtatccggcggattgatgaagacgcg
atccatcgtcaactggacagcggtgcaatagtgctaatggggccggtcgctgtttcagtc
actggcgagagctttaacctgacctcggaagagattgccactcaactggccatcaaactg
aaagctgaaaagatgattggtttttgctcttcccagggcgtcactaatgacgacggtgat
attgtctccgaacttttccctaacgaagcgcaagcgcgggtagaagcccaggaagagaaa
ggcgattacaactccggtacggtgcgctttttgcgtggcgcagtgaaagcctgccgcagc
ggcgtgcgtcgctgtcatttaatcagttatcaggaagatggcgcgctgttgcaagagttg
ttctcacgcgacggtatcggtacgcagattgtgatggaaagcgccgagcagattcgtcgc
gcaacaatcaacgatattggcggtattctggagttgattcgcccactggagcagcaaggt
attctggtacgccgttctcgcgagcagctggagatggaaatcgacaaattcaccattatt
cagcgcgataacacgactattgcctgcgccgcgctctatccgttcccggaagagaagatt
ggggaaatggcctgtgtggcagttcacccggattaccgcagttcatcaaggggtgaagtt
ctgctggaacgcattgccgctcaggcgaagcagagcggcttaagcaaattgtttgtgctg
accacgcgcagtattcactggttccaggaacgtggatttaccccagtggatattgattta
ctgcccgagagcaaaaagcagttgtacaactaccagcgtaaatccaaagtgttgatggcg
gatttagggtaa
              
                            

Download fasta file
RegulonDB