RegulonDB RegulonDB 10.9: Gene Sequence
argD gene sequence


Size: 1221        A: 261  T: 294  G: 376  C: 290

Fasta

 

>argD E. coli K12. Version NC_000913.3 GI:556503834
atggcaattgaacaaacagcaattacacgcgcgactttcgatgaagtgatcctgccgatt
tatgctccggcagagtttattccggtaaaaggtcagggcagccgaatctgggatcagcaa
ggcaaggagtatgtcgatttcgcgggtggcattgcagttacggcgttgggccattgccat
cctgcgctggtgaacgcgttaaaaacccagggcgaaactctgtggcatatcagtaacgtt
ttcaccaatgaaccggcgctgcgtcttgggcgtaaactgattgaggcaacgtttgccgaa
cgcgtggtgtttatgaactccggcacggaagctaacgaaaccgcctttaaactggcacgc
cattacgcctgtgtgcgtcatagcccgttcaaaaccaaaattattgccttccataacgct
tttcatggtcgctcgctgtttaccgtttcggtgggtgggcagccaaaatattccgacggc
tttgggccgaaaccggcagacatcatccacgttccctttaacgatctccatgcagtgaaa
gcggtgatggatgatcacacctgtgcggtggtggttgagccgatccagggcgagggcggt
gtgacggcagcgacgccagagtttttgcagggcttgcgcgagctgtgcgatcaacatcag
gcattattggtgtttgatgaagtgcagtgcgggatggggcggaccggcgatttgtttgct
tacatgcactacggcgttacgccggatattctgacctctgcgaaagcgttaggcggcggc
ttcccgattagcgccatgctgaccacggcggaaattgcttctgcgtttcatcctggttct
cacggttccacctacggcggtaatcctctggcctgtgcagtagcgggggcggcgtttgat
atcatcaatacccctgaagtgctggaaggcattcaggcgaaacgccagcgttttgttgac
catctgcagaagatcgatcagcagtacgatgtatttagcgatattcgcggtatggggctg
ttgattggcgcagagctgaaaccacagtacaaaggtcgggcgcgtgatttcctgtatgcg
ggcgcagaggctggcgtaatggtgctgaatgccggaccggatgtgatgcgttttgcaccg
tcgctggtggtggaagatgcggatatcgatgaagggatgcaacgtttcgcccacgcggtg
gcgaaggtggttggggcgtaa
              
                            

Download fasta file
RegulonDB