RegulonDB RegulonDB 10.10: Gene Sequence
argF gene sequence


Size: 1005        A: 231  T: 183  G: 335  C: 256

Fasta

 

>argF E. coli K12. Version NC_000913.3 GI:556503834
atgtccgatttatacaaaaaacactttctgaaactgctcgactttacccctgcacagttc
acttctctgctgacccttgccgcacagctcaaagccgataaaaaaaatggcaaggaagta
cagaagcttaccggtaaaaacatcgcgctcatcttcgaaaaagactcgactcgtacccgt
tgctctttcgaagttgccgcatttgaccagggcgcgcgcgttacctatttagggccgagc
ggcagccagattgggcataaagagtcaattaaggacaccgcgcgggttctcgggcggatg
tatgacggcattcagtatcgcggtcacggccaggaagtggtcgaaacgctggcgcagtat
gcgggcgtgccggtgtggaacgggctgaccaacgagttccacccgacccagctgctggcg
gacctgatgaccatgcaggagcacctgccgggcaaggcgtttaacgagatgacgctggtc
tacgcgggcgatgcgcgcaacaacatgggcaactcgatgctggaagcggcggcgctgacc
gggctggatctgcgcctgttggccccgaaagcctgctggccggaagagagcctggtggcg
gagtgcagcgcgctggcggagaagcacggcgggaaaattactctgacggaagacgtggcg
gcaggcgttaagggcgcggactttatctataccgacgtgtgggtgtcgatgggcgaggcc
aaagagaagtgggcagagcggattgcgctgctgcgcgggtatcaggtgaacgcgcagatg
atggcgctgaccgacaacccgaacgtgaagttcctgcactgtctgccggcgttccatgac
gaccagactacgctcggcaagcagatggcgaaggagttcgatctgcacggcgggatggag
gtgacggacgaggtgtttgagtcggcggcgagcatcgtgttcgaccaggcggaaaaccgg
atgcatacgattaaggcggtgatgatggcaacgcttggggagtga
              
                            

Download fasta file
RegulonDB