RegulonDB RegulonDB 10.9: Gene Sequence
argG gene sequence


Size: 1344        A: 334  T: 303  G: 370  C: 337

Fasta

 

>argG E. coli K12. Version NC_000913.3 GI:556503834
atgacgacgattctcaagcatctcccggtaggtcaacgtattggtatcgctttttctggc
ggtctggacaccagtgccgcactgctgtggatgcgacaaaagggagcggttccttatgca
tatactgcaaacctgggccagccagacgaagaggattatgatgcgatccctcgtcgtgcc
atggaatacggcgcggagaacgcacgtctgatcgactgccgcaaacaactggtggccgaa
ggtattgccgctattcagtgtggcgcatttcataacaccaccggcggcctgacctatttc
aacacgacgccgctgggccgcgccgtgactggtaccatgctggttgctgcgatgaaagaa
gatggcgtgaatatctggggtgacggtagcacctacaaaggaaacgatatcgaacgtttc
tatcgttatggtctgctgaccaatgctgaactgcagatttacaaaccgtggcttgatact
gactttattgatgaactgggcggccgtcatgagatgtctgaatttatgattgcctgcggt
ttcgactacaaaatgtctgtcgaaaaagcctactccacagactccaacatgcttggtgca
acgcatgaagcgaaggatctggaatacctcaactccagcgtcaaaatcgtcaacccgatt
atgggcgtgaaattctgggatgagagcgtgaagatcccggcagaagaagtcacagtacgc
tttgaacaaggtcatccggtggcgctgaacggtaaaacctttagcgacgacgtagaaatg
atgctggaagctaaccgcatcggcggtcgtcacggcctgggcatgagcgaccagattgaa
aaccgtatcatcgaagcgaaaagccgtggtatttacgaagctccggggatggcactgctg
cacattgcgtatgaacgcctgttgaccggtattcacaacgaagacaccattgagcagtat
cacgcgcatggtcgtcagttgggccgtctgctgtaccaggggcgttggtttgactcccag
gcgctgatgctgcgtgactctctgcaacgctgggttgccagccagatcactggtgaagtt
accctggagctgcgccgtgggaacgattattcaatcctgaataccgtctcagagaacctg
acctacaagccagagcgtctgacgatggaaaaaggcgactcggtgttctcgccagatgat
cgtattggtcaattgaccatgcgtaacctggatatcactgatacccgcgagaaacttttc
ggttatgccaaaactggcctgctttcctcctctgccgcttcaggcgtgccgcaggtggag
aatctggaaaacaaaggccagtaa
              
                            

Download fasta file
RegulonDB