RegulonDB RegulonDB 10.9: Gene Sequence
aroD gene sequence


Size: 759        A: 198  T: 178  G: 194  C: 189

Fasta

 

>aroD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaccgtaactgtaaaagatctcgtcattggtacgggcgcacctaaaatcatcgtc
tcgctgatggcgaaagatatcgccagcgtgaaatccgaagctctcgcctatcgtgaagcg
gactttgatattctggaatggcgtgtggaccactatgccgacctctccaatgtggagtct
gtcatggcggcagcaaaaattctccgtgagaccatgccagaaaaaccgctgctgtttacc
ttccgcagtgccaaagaaggcggcgagcaggcgatttccaccgaggcttatattgcactc
aatcgtgcagccatcgacagcggcctggttgatatgatcgatctggagttatttaccggt
gatgatcaggttaaagaaaccgtcgcctacgcccacgcgcatgatgtgaaagtagtcatg
tccaaccatgacttccataaaacgccggaagccgaagaaatcattgcccgtctgcgcaaa
atgcaatccttcgacgccgatattcctaagattgcgctgatgccgcaaagtaccagcgat
gtgctgacgttgcttgccgcgaccctggagatgcaggagcagtatgccgatcgtccaatt
atcacgatgtcgatggcaaaaactggcgtaatttctcgtctggctggtgaagtatttggc
tcggcggcaacttttggtgcggtaaaaaaagcgtctgcgccagggcaaatctcggtaaat
gatttgcgcacggtattaactattttacaccaggcataa
              
                            

Download fasta file
RegulonDB