RegulonDB RegulonDB 10.9: Gene Sequence
aroF gene sequence


Size: 1071        A: 267  T: 249  G: 291  C: 264

Fasta

 

>aroF E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaaagacgcgctgaataacgtacatattaccgacgaacaggttttaatgactccg
gaacaactgaaggccgcttttccattgagcctgcaacaagaagcccagattgctgactcg
cgtaaaagcatttcagatattatcgccgggcgcgatcctcgtctgctggtagtatgtggt
ccttgttccattcatgatccggaaactgctctggaatatgctcgtcgatttaaagccctt
gccgcagaggtcagcgatagcctctatctggtaatgcgcgtctattttgaaaaaccccgt
accactgtcggctggaaagggttaattaacgatccccatatggatggctcttttgatgta
gaagccgggctgcagatcgcgcgtaaattgctgcttgagctggtgaatatgggactgcca
ctggcgacggaagcgttagatccgaatagcccgcaatacctgggcgatctgtttagctgg
tcagcaattggtgctcgtacaacggaatcgcaaactcaccgtgaaatggcctccgggctt
tccatgccggttggttttaaaaacggcaccgacggcagtctggcaacagcaattaacgct
atgcgcgccgccgcccagccgcaccgttttgttggcattaaccaggcagggcaggttgcg
ttgctacaaactcaggggaatccggacggccatgtgatcctgcgcggtggtaaagcgccg
aactatagccctgcggatgttgcgcaatgtgaaaaagagatggaacaggcgggactgcgc
ccgtctctgatggtagattgcagccacggtaattccaataaagattatcgccgtcagcct
gcggtggcagaatccgtggttgctcaaatcaaagatggcaatcgctcaattattggtctg
atgatcgaaagtaatatccacgagggcaatcagtcttccgagcaaccgcgcagtgaaatg
aaatacggtgtatccgtaaccgatgcctgcattagctgggaaatgaccgatgccttgctg
cgtgaaattcatcaggatctgaacgggcagctgacggctcgcgtggcttaa
              
                            

Download fasta file
RegulonDB