RegulonDB RegulonDB 10.10: Gene Sequence
aroH gene sequence


Size: 1047        A: 259  T: 232  G: 270  C: 286

Fasta

 

>aroH E. coli K12. Version NC_000913.3 GI:556503834
atgaacagaactgacgaactccgtactgcgcgtattgagagcctggtaacgcccgccgaa
ctcgcgctacggtatcccgtaacgcctggcgtcgccacccatgtcaccgactcccgccgc
agaattgaaaaaatactgaatggtgaagataagcgactgttggtcattattggcccctgc
tcgatccacgatctcaccgctgcaatggagtacgccacccgtctgcagtcgctgcgcaac
cagtaccagtcacggctggaaatcgtaatgcgcacctattttgaaaaaccacgaactgtt
gtcggctggaaaggactaatctccgatccagatttaaacggcagctatcgggtaaatcac
ggtctggagctggcgcgcaaattacttttacaggtaaatgagctgggcgtcccaaccgcg
accgagttcctcgatatggtgaccggtcagtttattgctgatttaatcagttggggcgcg
attggcgcacgtactaccgaaagtcagatccaccgcgaaatggcttcggcactctcctgt
ccggtaggttttaaaaatggtaccgatggcaatacgcggattgctgtggatgctatccgc
gcagcccgcgccagccatatgttcctctcgccagacaaaaatggtcagatgaccatctat
cagaccagcggcaacccgtatggccacattattatgcgtggcggcaaaaaaccgaattat
catgccgatgatatcgccgcagcctgcgatacgctgcacgagtttgatttacctgaacat
ctggtggtggatttcagccacggtaactgccagaagcagcaccgtcgccagttagaagtt
tgtgaggatatttgtcagcaaatccgcaatggctctacggcgattgctggaattatggcg
gaaagtttcctgcgcgaaggaacgcaaaaaatcgtcggcagtcagccgctcacttacggt
caatccattaccgacccgtgtctgggctgggaggataccgaacgcctggtcgaaaaactc
gcctctgcggtagatacccgcttctga
              
                            

Download fasta file
RegulonDB