RegulonDB RegulonDB 11.0: Gene Sequence
aroL gene sequence


Size: 525        A: 135  T: 116  G: 147  C: 127

Fasta

 

>aroL E. coli K12. Version NC_000913.3 GI:556503834
atgacacaacctctttttctgatcgggcctcggggctgtggtaaaacaacggtcggaatg
gcccttgccgattcgcttaaccgtcggtttgtcgataccgatcagtggttgcaatcacag
ctcaatatgacggtcgcggagatcgtcgaaagggaagagtgggcgggatttcgcgccaga
gaaacggcggcgctggaagcggtaactgcgccatccaccgttatcgctacaggcggcggc
attattctgacggaatttaatcgtcacttcatgcaaaataacgggatcgtggtttatttg
tgtgcgccagtatcagtcctggttaaccgactgcaagctgcaccggaagaagatttacgg
ccaaccttaacgggaaaaccgctgagcgaagaagttcaggaagtgctggaagaacgcgat
gcgctatatcgcgaagttgcgcatattatcatcgacgcaacaaacgaacccagccaggtg
atttctgaaattcgcagcgccctggcacagacgatcaattgttga
              
                            

Download fasta file
RegulonDB