RegulonDB RegulonDB 10.8: Gene Sequence
aroM gene sequence


Size: 678        A: 176  T: 187  G: 175  C: 140

Fasta

 

>aroM E. coli K12. Version NC_000913.3 GI:556503834
atgagtgcgtcgttggcgatcctgaccatcggcattgtacctatgcaggaagttttgccg
ctcctgacggaatacattgacgaagataatatttcccatcatagcctgctggggaagtta
agtcgtgaagaagtgatggcggagtacgcgccagaagcaggcgaagacaccattctcaca
ttattaaatgacaaccagctggcccatgtttcgcgtcgcaaagtggagcgtgacctgcaa
ggtgtggttgaagtgctcgataatcagggttatgacgtcattttattaatgagtacagca
aacattagtagtatgactgcgcgtaatacgatctttcttgagccgtcgcgaatattgcct
ccactggtttcctctattgttgaagatcatcaggtgggggttatcgttccggttgaggag
atgctgcccgttcaggcgcaaaaatggcaaattttgcagaaatcgccggtattttcattg
ggtaaccccattcatgattcagaacaaaaaatcattgatgccgggaaagaattactggca
aaaggggctgatgtcatcatgctggattgtttaggatttcaccaacgtcatcgcgattta
ctgcaaaaacagctcgatgttcctgtcttgctgtctaacgtattgattgcacggctggct
gcggaattactggtgtaa
              
                            

Download fasta file
RegulonDB