RegulonDB RegulonDB 10.9: Gene Sequence
aroP gene sequence


Size: 1374        A: 281  T: 369  G: 389  C: 335

Fasta

 

>aroP E. coli K12. Version NC_000913.3 GI:556503834
atgatggaaggtcaacagcacggcgagcagctaaagcgcggccttaaaaaccgccatatt
cagcttatcgcgctgggtggcgcgatagggaccgggttattcctgggtagcgcctccgta
atacagtccgcagggccagggattatcctgggttacgccattgctggttttatcgccttt
ctgatcatgcgtcagctgggtgaaatggtggtcgaagaacctgtcgcaggctcctttagc
cactttgcttataaatactggggcagttttgccggtttcgcctctggctggaactactgg
gtactgtacgttttagttgccatggctgagctgactgccgtgggtaaatacattcagttc
tggtatccggaaatccccacctgggtttctgccgccgtattctttgtggtgattaacgcc
atcaacctgaccaacgttaaagtgtttggcgagatggagttctggtttgccattatcaaa
gttatcgcggtggtagcgatgatcatcttcggcggctggctgctattcagtggcaacggc
ggcccgcaggcgaccgttagcaacctgtgggatcagggtggtttcctgccgcacggcttc
accgggctggtgatgatgatggcgattatcatgttctcgttcggtggtctggaactggtg
gggatcaccgcagcagaagctgataacccggagcaaagtataccgaaagcaactaaccag
gttatctaccgcatcctgattttctatattggttcgttagccgttctgctctcactgatg
ccgtggacccgcgttaccgccgataccagtccgtttgtgctgatcttccacgagttaggc
gatacctttgtggcgaatgcgctgaacatcgtggtactgactgcggcgctctccgtgtac
aacagctgcgtatattgcaacagccgtatgctgtttggtctggcacaacagggtaatgcg
ccaaaagcgctggcgtctgtcgataaacgtggtgtaccagtaaataccattctggtgtct
gcactggtaacggcgttgtgcgtactgattaactaccttgccccagagtccgctttcgga
ctgttaatggcgctggtggtatctgcactggtaatcaactgggcgatgattagcctggcg
catatgaaattccgtcgcgccaagcaggaacaaggcgtggtaactcgcttccctgctctg
ctttatccgctgggtaactggatctgcctgctgtttatggcggcggtactggtgattatg
ctgatgaccccaggaatggcgatttcggtatacctgatcccggtatggctgatcgtgtta
ggtatcggctatctgtttaaagagaaaaccgccaaagccgtaaaagcgcattaa
              
                            

Download fasta file
RegulonDB