RegulonDB RegulonDB 10.10: Gene Sequence
asnB gene sequence


Size: 1665        A: 409  T: 388  G: 452  C: 416

Fasta

 

>asnB E. coli K12. Version NC_000913.3 GI:556503834
atgtgttcaatttttggcgtattcgatatcaaaacagacgcagttgagctgcgtaagaaa
gccctcgagctgtcacgcctgatgcgtcatcgtggcccggactggtccggtatttatgcc
agcgataacgccattctcgcccacgaacgtctgtcaattgttgacgttaacgcgggggcg
caacctctctacaaccaacaaaaaacccacgtactggcggtaaacggtgaaatctacaac
caccaggcattgcgcgccgaatatggcgatcgttaccagttccagaccgggtctgactgt
gaagtgatcctcgcgctgtatcaggaaaaagggccggaatttctcgacgacttgcagggc
atgtttgcctttgcactgtacgacagcgaaaaagatgcctacctgattggtcgcgaccat
ctggggatcatcccactgtatatggggtatgacgaacacggtcagctgtatgtggcctca
gaaatgaaagcgctggtgccagtttgccgcacgattaaagagttcccggcggggagctat
ttgtggagccaggacggcgaaatccgttcttactatcatcgcgactggttcgactacgat
gcggtgaaagataacgtgaccgacaaaaacgagctgcgtcaggcactggaagattcagtt
aaaagccatctgatgtctgatgtgccttacggtgtgctgctttctggtggtctggattcc
tcaattatttccgctatcaccaagaaatacgcagcccgtcgcgtggaagatcaggaacgc
tctgaagcctggtggccgcagttacactcctttgctgtaggtctgccgggttcaccggat
ctgaaagcagcccaggaagtggcaaaccatctgggcacggtgcatcacgaaattcacttc
actgtacaggaaggtctggatgccatccgcgacgtgatttaccacatcgaaacttatgat
gtgaccactattcgcgcttcaacaccgatgtatttaatgtcgcgtaagatcaaggcgatg
ggcattaaaatggtgctgtccggtgaaggttctgatgaagtgttcggcggttatctttac
ttccacaaagcaccgaatgccaaagaactgcatgaagagacggtgcgtaaactgctggcc
ctgcatatgtatgactgcgcgcgtgccaacaaagcgatgtcagcctggggcgtggaagca
cgcgttccgttcctcgacaaaaaattccttgatgtggcgatgcgtattaacccacaggat
aaaatgtgcggtaacggcaaaatggaaaaacacatcctgcgtgaatgttttgaagcgtat
ctgcctgcaagcgtggcctggcggcagaaagagcagttctccgatggcgtcggttacagt
tggatcgacaccctgaaagaagtggctgcgcagcaggtttctgatcagcaactggaaact
gcccgcttccgcttcccgtacaacacgccaacctctaaagaagcgtacttgtatcgggag
atctttgaagaactattcccgcttccgagcgccgctgagtgcgtgccgggcggtccttcc
gtcgcttgttcttccgctaaagcgatcgaatgggatgaagcgttcaagaaaatggacgat
ccgtctggtcgcgcggttggtgttcaccagtcggcgtataagtaa
              
                            

Download fasta file
RegulonDB