RegulonDB RegulonDB 10.10: Gene Sequence
asnC gene sequence


Size: 459        A: 131  T: 101  G: 111  C: 116

Fasta

 

>asnC E. coli K12. Version NC_000913.3 GI:556503834
atggaaaattatctgatcgacaatctggaccgtggcatcctggaagcattaatgggcaat
gcgcgcaccgcttacgccgaactggcgaaacaatttggcgtcagtccggggacgattcac
gttcgagtagagaaaatgaagcaggcggggatcattaccggggcgcgtattgatgtcagc
ccgaagcagctcggttatgacgtaggctgctttatcggcattatattaaagagcgccaaa
gactacccttccgcgctggcaaagctggaaagccttgatgaagtcactgaagcctattac
acaaccggccactacagcatctttataaaagtgatgtgccgttcgatcgacgctctccag
catgtacttatcaacaagatccaaacaattgatgaaattcagtccaccgagacattgatc
gtcctgcaaaacccgatcatgcgtaccatcaagccctga
              
                            

Download fasta file
RegulonDB