RegulonDB RegulonDB 10.9: Gene Sequence
aspS gene sequence


Size: 1773        A: 417  T: 403  G: 502  C: 451

Fasta

 

>aspS E. coli K12. Version NC_000913.3 GI:556503834
atgcgtacagaatattgtggacagctccgtttgtcccacgtggggcagcaggtgactctg
tgtggttgggtcaaccgtcgtcgtgatcttggtagcctgatcttcatcgatatgcgcgac
cgcgaaggtatcgtgcaggtatttttcgatccggatcgtgcggacgcgttaaagctggcc
tctgaactgcgtaatgagttctgcattcaggtcacgggcaccgtacgtgcgcgtgacgaa
aaaaatattaaccgcgatatggcgaccggcgaaatcgaagtgctggcgtcctcgctgact
atcatcaaccgcgcagatgttctgccgcttgactctaaccacgtcaacaccgaagaagcg
cgtctgaaataccgctacctcgacctgcgtcgtccggaaatggctcagcgcctgaaaacc
cgcgctaaaatcaccagcctggtgcgccgttttatggatgaccacggcttcctcgacatc
gaaactccgatgctgaccaaagccacgccggaaggcgcgcgtgactacctggtgccttct
cgtgtgcacaaaggtaaattctacgcactgccgcaatccccgcagttgttcaaacagctg
ctgatgatgtccggttttgaccgttactatcagatcgttaaatgcttccgtgacgaagac
ctgcgtgctgaccgtcagcctgaatttactcagatcgatgtggaaacttctttcatgacc
gcgccgcaagtgcgtgaagtgatggaagcgctggtgcgtcatctgtggctggaagtgaag
ggtgtggatctgggcgatttcccggtaatgacctttgcggaagcagaacgccgttatggt
tctgataaaccggatctgcgtaacccgatggaactgactgacgttgctgatctgctgaaa
tctgttgagtttgctgtatttgcaggtccggcgaacgatccgaaaggtcgcgtagcggct
ctgcgcgttccgggcggcgcatcgctgacccgtaagcagatcgacgaatacggtaacttc
gttaaaatctacggcgcgaaaggtctggcttacatcaaagttaacgaacgcgcgaaaggt
ctggaaggtatcaacagcccggtagcgaagttccttaatgcagaaatcatcgaagacatc
ctggatcgtactgccgcgcaagatggcgatatgattttcttcggtgccgacaacaagaaa
attgttgccgacgcgatgggtgcactgcgcctgaaagtgggtaaagaccttggtctgacc
gacgaaagcaaatgggcaccgctgtgggttatcgacttcccgatgtttgaagacgacggt
gaaggcggcctgacggcaatgcaccatccgttcacctcaccgaaagatatgacggctgca
gaactgaaagctgcaccggaaaatgcggtggcgaacgcttacgatatggtcatcaatggt
tacgaagtgggcggtggttcagtacgtatccataatggtgatatgcagcagacggtgttt
ggtattctgggtatcaacgaagaggaacagcgcgagaaattcggcttcctgctcgacgct
ctgaaatacggtactccgccgcacgcaggtctggcattcggtcttgaccgtctgaccatg
ctgctgaccggcaccgacaatatccgtgacgttatcgccttcccgaaaaccacggcggca
gcgtgtctgatgactgaagcaccgagctttgctaacccgactgcactggctgagctgagc
attcaggttgtgaagaaggctgagaataactga
              
                            

Download fasta file
RegulonDB