RegulonDB RegulonDB 10.9: Gene Sequence
betT gene sequence


Size: 2034        A: 386  T: 523  G: 601  C: 524

Fasta

 

>betT E. coli K12. Version NC_000913.3 GI:556503834
atgacagacctttcacacagcagggaaaaggacaaaatcaatccggtggtgttttacacc
tccgccggactgattttgttgttttccctgacaacgatcctgtttcgcgacttctcggcc
ctgtggattggccgcacgctggactgggtttctaaaaccttcggttggtactatctgctg
gcggcaacgctctatattgtctttgtggtctgtatcgcttgttcgcgttttggttcggtg
aagctcgggccagaacaatccaaaccggaattcagcctgctgagttgggcggcgatgctg
tttgctgccgggatcggtatcgacctgatgttcttctccgtagccgaaccggtaacgcag
tatatgcagccgccggaaggcgcgggacagacgattgaggccgcgcgtcaggcgatggtc
tggacgctgtttcactacggcttaaccggctggtcgatgtatgcgctgatgggcatggcg
ctcggatactttagctatcgttataatttgccgctcaccatccgctcggcgctgtacccg
atcttcggtaaacggattaacgggccgataggtcactcagtggatattgcagcggtgatc
ggcactatcttcggtattgccactacgctcggtatcggtgtggtgcagcttaactatggc
ttgagcgtactgtttgatattcccgattcgatggcggcgaaagcggcactgatcgccttg
tcggtgataatcgccacgatctctgtcacctccggtgtcgataagggcattcgcgtgtta
tcggagcttaatgtcgcgctggcgctgggattgatcctgttcgtattgtttatgggcgac
acttcgttcctgcttaatgcactggtgctgaatgttggcgactatgtgaatcgctttatg
ggcatgacgctcaacagttttgccttcgaccgtccggttgagtggatgaataactggacg
ctcttcttctgggcatggtgggtggcatggtcgccgtttgtcggcttgttcctggcgcgt
atctcgcgtgggcgtaccattcgccagttcgtgctgggcacgttgattattccgtttacc
ttcacgctgttatggctctcggtgttcggcaatagcgcgctgtatgaaatcatccacggc
ggcgcggcatttgccgaggaagcgatggtccatccggagcgcggcttctacagcctgctg
gcgcagtatccggcgtttacctttagcgcctccgtcgccaccattactggcctgctgttt
tatgtgacctcggcggactccggggcgctggtgctggggaatttcacctcgcagcttaaa
gatatcaacagcgacgcccccggctggctgcgcgtcttctggtcggtggcgattggcctg
ctgacgctcggcatgctgatgactaacgggatatccgcgctgcaaaacaccacggtgatt
atggggctgccgttcagctttgtgatcttcttcgtgatggcggggttgtataaatctctg
aaggtagaagattaccgccgtgaaagtgccaaccgcgataccgcaccgcgaccgctgggg
cttcaggatcgcctgagctggaaaaaacgtctctcgcgcctgatgaattatccgggcacg
cgttacactaaacagatgatggagacggtctgttacccggcaatggaagaagtggcgcag
gagttgcggttgcgcggcgcgtacgtggagctaaaaagcctgccaccggaagagggacag
cagttgggtcatctggatttgttggtgcatatgggcgaagagcaaaactttgtctatcag
atttggccgcagcaatattcggtgccgggctttacctaccgcgcacgcagcggtaaatcg
acctactaccggctggaaaccttcctgttagaaggcagccagggcaacgacctgatggac
tacagcaaagagcaggtgatcaccgatattcttgaccagtacgagcggcaccttaacttt
attcatctccatcgtgaagcgccgggccatagcgtgatgttcccggacgcgtga
              
                            

Download fasta file
RegulonDB