RegulonDB RegulonDB 10.8: Gene Sequence
bglB gene sequence


Size: 1413        A: 379  T: 348  G: 381  C: 305

Fasta

 

>bglB E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcatttccagaaacatttctttggggtggcgcaacagctgccaatcaggtggaa
ggtgcctggcaggaagatggcaaagggatctcgacctcagatttacagcctcatggcgta
atgggaaaaatggaaccgcgcatcctggggaaagagaatatcaaagatgtcgccatcgat
ttttatcaccgttacccggaagatatcgcgttatttgccgagatgggcttcacctgtctg
cgtatttccattgcctgggcgcgaattttccctcagggcgacgaagtcgaaccgaatgaa
gcggggttagcgttttacgatcggctgtttgatgaaatggcgcaggcggggatcaagccg
ctggtaacgttatcccattacgaaatgccatatgggctggtgaaaaactacggcggttgg
gctaatcgagcggtcatcgatcacttcgagcattacgcccgcacggtctttactcgctac
caacataaagtggcgttatggctgacgtttaatgaaatcaacatgtcgttacacgcgcca
ttcacgggcgtggggctggcagaagagagtggcgaggcggaagtttatcaggctatccac
catcaactggttgccagtgcgcgggcagttaaagcctgtcatagcctgctccccgaagcg
aaaatcggcaatatgcttctcggtgggctggtttaccccctcacctgccagccacaggat
atgttgcaggccatggaagagaaccggcgctggatgttctttggtgatgttcaggcgcgt
ggccagtatcccggctatatgcagcgtttcttccgcgaccacaatatcaccattgagatg
actgaaagtgacgcagaagatttaaaacataccgtcgatttcatctcttttagttattac
atgactggttgtgtttcccacgacgaaagcattaataaaaatgcgcagggcaacatactg
aatatgatccccaatccgcatctgaaaagttcagagtgggggtggcaaattgatccggtt
ggattacgggttctgttaaatacgctttgggatcgttatcaaaaaccgttatttattgtc
gagaacggattaggcgcaaaagacagcgttgaagcggatggttcgatacaggacgattat
cgaattgcctatttaaacgatcacctggtacaggtaaatgaagcgattgccgatggtgtg
gatattatggggtacaccagttgggggccaattgatttagtcagtgcatctcattcacaa
atgtctaagcgctacggctttatttatgtggatcgtgatgataatggcgaaggaagcctc
acaagaacacgcaagaaaagcttcggatggtatgcagaggtgatcaagacgcgggggctg
tcattaaaaaaaataaccattaaagcaccttaa
              
                            

Download fasta file
RegulonDB