RegulonDB RegulonDB 11.0: Gene Sequence
bioC gene sequence


Size: 756        A: 163  T: 166  G: 221  C: 206

Fasta

 

>bioC E. coli K12. Version NC_000913.3 GI:556503834
atggcaacggttaataaacaagccattgcagcggcatttggtcgggcagccgcacactat
gagcaacatgcagatctacagcgccagagtgctgacgccttactggcaatgcttccacag
cgtaaatacacccacgtactggacgcgggttgtggacctggctggatgagccgccactgg
cgggaacgtcacgcgcaggtgacggccttagatctctcgccgccaatgcttgttcaggca
cgccagaaggatgccgcagaccattatctggcgggagatatcgaatccctgccgttagcg
actgcgacgttcgatcttgcatggagcaatctcgcagtgcagtggtgcggtaatttatcc
acggcactccgcgagctgtatcgggtggtgcgccccaaaggcgtggtcgcgtttaccacg
ctggtgcagggatcgttacccgaactgcatcaggcgtggcaggcggtggacgagcgtccg
catgctaatcgctttttaccgccagatgaaatcgaacagtcgctgaacggcgtgcattat
caacatcatattcagcccatcacgctgtggtttgatgatgcgctcagtgccatgcgttcg
ctgaaaggcatcggtgccacgcatcttcatgaagggcgcgacccgcgaatattaacgcgt
tcgcagttgcagcgattgcaactggcctggccgcaacagcaggggcgatatcctctgacg
tatcatctttttttgggagtgattgctcgtgagtaa
              
                            

Download fasta file
RegulonDB