RegulonDB RegulonDB 10.9: Gene Sequence
bioF gene sequence


Size: 1155        A: 229  T: 256  G: 366  C: 304

Fasta

 

>bioF E. coli K12. Version NC_000913.3 GI:556503834
atgagctggcaggagaaaatcaacgcggcgctcgatgcgcggcgtgctgccgatgccctg
cgtcgccgttatccggtggcgcaaggagccggacgctggctggtggcggatgatcgccag
tatctgaacttttccagtaacgattatttaggtttaagccatcatccgcaaattatccgt
gcctggcagcagggggcggagcaatttggcatcggtagcggcggctccggtcacgtcagc
ggttatagcgtggtgcatcaggcactggaagaagagctggccgagtggcttggctattcg
cgggcactgctgtttatctctggtttcgccgctaatcaggcagttattgccgcgatgatg
gcgaaagaggaccgtattgctgccgaccggcttagccatgcctcattgctggaagctgcc
agtttaagcccgtcgcagcttcgccgttttgctcataacgatgtcactcatttggcgcga
ttgcttgcttccccctgtccggggcagcaaatggtggtgacagaaggcgtgttcagcatg
gacggcgatagtgcgccactggcggaaatccagcaggtaacgcaacagcacaatggctgg
ttgatggtcgatgatgcccacggcacgggcgttatcggggagcaggggcgcggcagctgc
tggctgcaaaaggtaaaaccagaattgctggtagtgacttttggcaaaggatttggcgtc
agcggggcagcggtgctttgctccagtacggtggcggattatctgctgcaattcgcccgc
caccttatctacagcaccagtatgccgcccgctcaggcgcaggcattacgtgcgtcgctg
gcggtcattcgcagtgatgagggtgatgcacggcgcgaaaaactggcggcactcattacg
cgttttcgtgccggagtacaggatttgccgtttacgcttgctgattcatgcagcgccatc
cagccattgattgtcggtgataacagccgtgcgttacaactggcagaaaaactgcgtcag
caaggctgctgggtcacggcgattcgcccgccaaccgtacccgctggtactgcgcgactg
cgcttaacgctaaccgctgcgcatgaaatgcaggatatcgaccgtctgctggaggtgctg
catggcaacggttaa
              
                            

Download fasta file
RegulonDB