RegulonDB RegulonDB 10.9: Gene Sequence
btuB gene sequence


Size: 1845        A: 453  T: 465  G: 490  C: 437

Fasta

 

>btuB E. coli K12. Version NC_000913.3 GI:556503834
atgattaaaaaagcttcgctgctgacggcgtgttccgtcacggcattttccgcttgggca
caggataccagcccggatactctcgtcgttactgctaaccgttttgaacagccgcgcagc
actgtgcttgcaccaaccaccgttgtgacccgtcaggatatcgaccgctggcagtcgacc
tcggtcaatgatgtgctgcgccgtcttccgggcgtcgatatcacccaaaacggcggttca
ggtcagctctcatctatttttattcgcggtacaaatgccagtcatgtgttggtgttaatt
gatggcgtacgcctgaatctggcgggggtgagtggttctgccgaccttagccagttccct
attgcgcttgtccagcgtgttgaatatatccgtgggccgcgctccgctgtttatggttcc
gatgcaataggcggggtggtgaatatcatcacgacgcgcgatgaacccggaacggaaatt
tcagcagggtggggaagcaatagttatcagaactatgatgtctctacgcagcaacaactg
ggggataagacacgggtaacgctgttgggcgattatgcccatactcatggttatgatgtt
gttgcctatggtaataccggaacgcaagcgcagacagataacgatggttttttaagtaaa
acgctttatggcgcgctggagcataactttactgatgcctggagcggctttgtgcgcggc
tatggctatgataaccgtaccaattatgacgcgtattattctcccggttcaccgttgctc
gatacccgtaaactctatagccaaagttgggacgccgggctgcgctataacggcgaactg
attaaatcacaactcattaccagctatagccatagcaaagattacaactacgatccccat
tatggtcgttatgattcgtcggcgacgctcgatgagatgaagcaatacaccgtccagtgg
gcaaacaatgtcatcgttggtcacggtagtattggtgcgggtgtcgactggcagaaacag
actacgacgccgggtacaggttatgttgaggatggatatgatcaacgtaataccggcatc
tatctgaccgggctgcaacaagtcggcgattttacctttgaaggcgcagcacgcagtgac
gataactcacagtttggtcgtcatggaacctggcaaaccagcgccggttgggaattcatc
gaaggttatcgcttcattgcttcctacgggacatcttataaggcaccaaatctggggcaa
ctgtatggcttctacggaaatccgaatctggacccggagaaaagcaaacagtgggaaggc
gcgtttgaaggcttaaccgctggggtgaactggcgtatttccggatatcgtaacgatgtc
agtgacttgatcgattatgatgatcacaccctgaaatattacaacgaagggaaagcgcgg
attaagggcgtcgaggcgaccgccaattttgataccggaccactgacgcatactgtgagt
tatgattatgtcgatgcgcgcaatgcgattaccgacacgccgttgttacgccgtgctaaa
cagcaggtgaaataccagctcgactggcagttgtatgacttcgactggggtattacttat
cagtatttaggcactcgctatgataaggattactcatcttatccttatcaaaccgttaaa
atgggcggtgtgagcttgtgggatcttgcggttgcgtatccggtcacctctcacctgaca
gttcgtggtaaaatagccaacctgttcgacaaagattatgagacagtctatggctaccaa
actgcaggacgggaatacaccttgtctggcagctacaccttctga
              
                            

Download fasta file
RegulonDB