RegulonDB RegulonDB 10.8: Gene Sequence
btuC gene sequence


Size: 981        A: 156  T: 281  G: 302  C: 242

Fasta

 

>btuC E. coli K12. Version NC_000913.3 GI:556503834
atgctgacacttgcccgccaacaacagcgacaaaatattcgctggttattatgcctgtca
gttttgatgctgctggcgcttctcttaagcctttgcgccggtgaacaatggatctcgcca
ggtgactggtttactcctcgtggcgaactgttcgtctggcaaattcgcctgccacgtacg
ctggctgtattgctggttggtgcggcgctggctatatccggcgctgtaatgcaggcgttg
tttgaaaatcctctggcagaacctggactacttggcgtctctaacggcgcaggcgtgggg
cttatcgccgcggtattgcttgggcaagggcaactccccaactgggcgctagggctgtgt
gcgattgctggcgcgcttatcatcactttaatactcttacgtttcgcccgtcgtcatctt
tcgaccagtcggttattgctggctggcgttgcattagggattatctgtagcgcactaatg
acgtgggctatctacttttccacctcagttgatttgcgtcagctgatgtactggatgatg
ggcggttttggcggcgtagactggcggcaaagctggctgatgctggcattgatccccgtg
ttgttgtggatctgttgtcagtccaggccgatgaatatgttagcacttggcgagatctcg
gcgcggcaactgggtttacccctgtggttctggcgcaatgtgctggtggcagcgaccggc
tggatggttggcgtcagtgtggcgctggcgggtgctatcggctttattggtctggtgatc
ccccatattctccggttgtgtggtttaaccgatcatcgcgtattacttcccggctgcgcg
ctggcaggggcgagcgcattgctgctggccgatattgtagcgcgcctggcattagctgcc
gcagagctgcctattggcgtggtcaccgcaacgttaggtgcgccggtgtttatctggtta
ttgttaaaagcaggacgttag
              
                            

Download fasta file
RegulonDB