RegulonDB RegulonDB 10.9: Gene Sequence
btuD gene sequence


Size: 750        A: 178  T: 158  G: 221  C: 193

Fasta

 

>btuD E. coli K12. Version NC_000913.3 GI:556503834
atgtctattgtgatgcagttacaagatgttgcggaatctacccgcctggggccgctttct
ggcgaggttcgggctggggagatcctgcacctggtggggccgaatggcgcgggtaagagt
accttactggcgcgaatggccggaatgaccagcggtaagggaagcattcagttcgcgggg
caaccactggaagcatggtccgcaacaaaactcgcgctgcatcgcgcctatctttcacaa
cagcagacgccgccgtttgcaacgccggtctggcactacctgacactgcatcagcacgat
aaaacgcgtaccgaactactgaatgatgtcgcaggggcgctggctcttgatgacaaactc
ggacgtagcaccaatcaactttccggcggtgaatggcaacgcgtacgtcttgctgcggtg
gtgttgcaaatcacaccacaagccaatcccgcaggccaattgctgcttcttgatgagccg
atgaacagtcttgatgttgcgcaacaaagtgcgttagacaaaattctgagcgcgctgtgt
cagcaaggactggcgattgtgatgagcagtcacgatctcaaccacacattgcgtcatgcg
catcgggcgtggttgctaaaaggtggaaaaatgctggccagtggacgcagggaagaggtg
ctcacgccgccaaatctggcgcaggcctatgggatgaattttcgccgtctggatatcgaa
ggtcacagaatgctgatttcgaccatctga
              
                            

Download fasta file
RegulonDB