RegulonDB RegulonDB 11.1: Gene Sequence
btuR gene sequence


Size: 591        A: 160  T: 134  G: 169  C: 128

Fasta

 

>btuR E. coli K12. Version NC_000913.3 GI:556503834
atgagtgatgaacgctaccaacagcgtcagcagcgagtgaaagaaaaagtagatgctcgt
gtggcccaggcccaggatgaacgcggtattatcatcgtctttaccggcaatggaaaaggc
aaaaccaccgcggcatttggtacggcaacacgcgcagttggtcacggaaaaaaagtaggc
gtcgtgcagtttattaaaggcacctggcctaatggcgaacgcaatctgctggagccacat
ggcgttgagtttcaggtgatggcaacgggctttacctgggatacacaaaaccgcgagtct
gataccgccgcctgccgcgaagtctggcaacatgcaaagcggatgcttgctgattcctca
ctggatatggttttgcttgatgaactgacgtatatggtggcgtatgactatttgccactg
gaagaagtggtgcaggcgttaaatgaacgtccacatcaacagacggtgattatcacgggt
cgtggttgtcatcgggatattcttgaactggcagatacggtaagtgaattacgccccgtc
aaacatgcgtttgatgccggtgtaaaagcgcagatagggatcgattattaa
              
                            

Download fasta file
RegulonDB