RegulonDB RegulonDB 10.9: Gene Sequence
cadA gene sequence


Size: 2148        A: 588  T: 538  G: 497  C: 525

Fasta

 

>cadA E. coli K12. Version NC_000913.3 GI:556503834
atgaacgttattgcaatattgaatcacatgggggtttattttaaagaagaacccatccgt
gaacttcatcgcgcgcttgaacgtctgaacttccagattgtttacccgaacgaccgtgac
gacttattaaaactgatcgaaaacaatgcgcgtctgtgcggcgttatttttgactgggat
aaatataatctcgagctgtgcgaagaaattagcaaaatgaacgagaacctgccgttgtac
gcgttcgctaatacgtattccactctcgatgtaagcctgaatgacctgcgtttacagatt
agcttctttgaatatgcgctgggtgctgctgaagatattgctaataagatcaagcagacc
actgacgaatatatcaacactattctgcctccgctgactaaagcactgtttaaatatgtt
cgtgaaggtaaatatactttctgtactcctggtcacatgggcggtactgcattccagaaa
agcccggtaggtagcctgttctatgatttctttggtccgaataccatgaaatctgatatt
tccatttcagtatctgaactgggttctctgctggatcacagtggtccacacaaagaagca
gaacagtatatcgctcgcgtctttaacgcagaccgcagctacatggtgaccaacggtact
tccactgcgaacaaaattgttggtatgtactctgctccagcaggcagcaccattctgatt
gaccgtaactgccacaaatcgctgacccacctgatgatgatgagcgatgttacgccaatc
tatttccgcccgacccgtaacgcttacggtattcttggtggtatcccacagagtgaattc
cagcacgctaccattgctaagcgcgtgaaagaaacaccaaacgcaacctggccggtacat
gctgtaattaccaactctacctatgatggtctgctgtacaacaccgacttcatcaagaaa
acactggatgtgaaatccatccactttgactccgcgtgggtgccttacaccaacttctca
ccgatttacgaaggtaaatgcggtatgagcggtggccgtgtagaagggaaagtgatttac
gaaacccagtccactcacaaactgctggcggcgttctctcaggcttccatgatccacgtt
aaaggtgacgtaaacgaagaaacctttaacgaagcctacatgatgcacaccaccacttct
ccgcactacggtatcgtggcgtccactgaaaccgctgcggcgatgatgaaaggcaatgca
ggtaagcgtctgatcaacggttctattgaacgtgcgatcaaattccgtaaagagatcaaa
cgtctgagaacggaatctgatggctggttctttgatgtatggcagccggatcatatcgat
acgactgaatgctggccgctgcgttctgacagcacctggcacggcttcaaaaacatcgat
aacgagcacatgtatcttgacccgatcaaagtcaccctgctgactccggggatggaaaaa
gacggcaccatgagcgactttggtattccggccagcatcgtggcgaaatacctcgacgaa
catggcatcgttgttgagaaaaccggtccgtataacctgctgttcctgttcagcatcggt
atcgataagaccaaagcactgagcctgctgcgtgctctgactgactttaaacgtgcgttc
gacctgaacctgcgtgtgaaaaacatgctgccgtctctgtatcgtgaagatcctgaattc
tatgaaaacatgcgtattcaggaactggctcagaatatccacaaactgattgttcaccac
aatctgccggatctgatgtatcgcgcatttgaagtgctgccgacgatggtaatgactccg
tatgctgcattccagaaagagctgcacggtatgaccgaagaagtttacctcgacgaaatg
gtaggtcgtattaacgccaatatgatccttccgtacccgccgggagttcctctggtaatg
ccgggtgaaatgatcaccgaagaaagccgtccggttctggagttcctgcagatgctgtgt
gaaatcggcgctcactatccgggctttgaaaccgatattcacggtgcataccgtcaggct
gatggccgctataccgttaaggtattgaaagaagaaagcaaaaaataa
              
                            

Download fasta file
RegulonDB