RegulonDB RegulonDB 10.9: Gene Sequence
cdd gene sequence


Size: 885        A: 196  T: 205  G: 248  C: 236

Fasta

 

>cdd E. coli K12. Version NC_000913.3 GI:556503834
atgcatccacgttttcaaaccgcttttgcccaacttgcggataacttgcaatctgcactg
gaacctattctggcagacaagtacttccccgctttgttgaccggggagcaagtctcatcg
ctgaagagcgcaacggggctggacgaagacgcgctggcattcgcactacttccgctggcg
gcggcctgtgcgcgtacgccattgtcgaattttaatgttggcgcaattgcgcgcggtgtg
agcggaacctggtatttcggtgccaatatggaatttattggtgcgacaatgcagcaaacc
gttcatgccgaacaaagcgcgatcagccacgcctggttgagtggtgaaaaagcgcttgca
gccatcaccgttaactacacgccttgtggtcactgccgtcagtttatgaatgaactgaac
agcggtctggatctgcgtattcatctgccgggccgcgaggcacacgcgctgcgtgactat
ctgccagatgcctttgggccgaaagatctggagattaaaacgctgctgatggacgaacag
gatcacggctatgcgctgacgggtgatgcgctttctcaggcagcgattgcggcggcaaac
cgttcgcacatgccttacagtaagtcgccaagcggtgtcgcgctggaatgtaaagacggt
cgtattttcagtggcagctacgctgaaaacgccgcattcaacccgactctgccaccgttg
cagggagcgttaattctgttgaatctcaagggttatgattacccggatatccagcgcgcg
gttctggcagaaaaagccgatgcgccgttgattcagtgggatgccacctccgcaacgctg
aaagctctcggctgtcacagtatcgaccgagtgcttctcgcttaa
              
                            

Download fasta file
RegulonDB