RegulonDB RegulonDB 10.9: Gene Sequence
cdh gene sequence


Size: 756        A: 190  T: 198  G: 198  C: 170

Fasta

 

>cdh E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagcgggtcttctttttttggtgatgatagttatcgccgttgtggctgccggt
attggttactggaaattaaccggtgaagagtcggatacattacgtaagattgtccttgag
gaatgtttgcccaatcagcagcaaaatcaaaatccttcgccatgtgcggaagtcaaaccc
aatgccggatacgtggttttaaaagatcttaatggcccactgcaatatctgttgatgcca
acgtatcgtattaacggtactgaaagtcctttgttgaccgatccttcaacgccgaacttc
ttttggttggcttggcaggcgcgtgattttatgagcaaaaaatacggccagccggttccc
gatcgcgcggtttctttggcgatcaactcccgcaccgggcgtacgcaaaaccattttcat
attcatatctcttgtattcgtcctgatgtgcgcaaacagctggataacaatctggcgaac
atcagcagccgctggttgccactgccaggtggtttgcgcgggcatgaatacctggcgcgt
cgggtaacggaaagcgaactggtacaacgcagcccatttatgatgctggcagaagaagta
cctgaggcgcgggaacatatgggacgctacgggctggcgatggtacggcagagtgataac
tcatttgtattgctggcgacacaacgaaatctactgacgcttaaccgtgcttcagccgag
gaaattcaggatcatcagtgtgagattttgcgttaa
              
                            

Download fasta file
RegulonDB