RegulonDB RegulonDB 10.9: Gene Sequence
cdsA gene sequence


Size: 858        A: 155  T: 267  G: 245  C: 191

Fasta

 

>cdsA E. coli K12. Version NC_000913.3 GI:556503834
ttgctgaagtatcgcctgatatctgcttttgtgttaatacccgtcgtcatcgcggcgttg
tttctgttgccgccggtggggttcgccattgtaacgctggtggtctgcatgctggcagcg
tgggaatggggacagcttagcggttttaccactcgttcgcagcgagtatggttggcggtg
ttatgcgggttattgttggcgctgatgctttttctgttgccggaatatcaccgaaatatt
catcaaccgctggttgaaatctcactttgggcttcgctgggttggtggattgtcgcgcta
ttgctggtgctgttttacccaggttccgcagcaatctggcgtaactctaaaacattgcgc
cttatttttggcgtgctaaccattgttcccttcttctggggcatgctggcgttacgggcc
tggcactatgacgagaatcattacagtggcgcaatatggctgctctatgtcatgatcctg
gtatggggcgctgactccggcgcatatatgtttggcaaattgtttggtaaacataagctg
gcaccgaaggtttctccgggtaaaacctggcaaggctttatcggtggactcgctactgca
gcggtaatctcatggggttatggcatgtgggcgaatctcgacgtcgctcccgtcacctta
ctcatttgctctattgtcgcagcgttagcctcagtgctcggcgatctgaccgagagtatg
tttaagcgtgaagcaggaattaaggacagcggtcatttaattccaggacacggtggtatt
ttagatcgtattgatagcctgacggctgcggtaccggtctttgcttgcttgttgttactg
gtattcaggacgctttaa
              
                            

Download fasta file
RegulonDB