RegulonDB RegulonDB 11.1: Gene Sequence
chbF gene sequence


Size: 1353        A: 364  T: 356  G: 354  C: 279

Fasta

 

>chbF E. coli K12. Version NC_000913.3 GI:556503834
atgagccagaaattaaaagtcgtcactattggtggcgggagcagctataccccggagtta
ctggaaggatttattaagcgttatcacgaattgccggtcagcgaattatggctggtggat
gtcgaaggtggtaaaccgaaactggatattattttcgatctctgccaacggatgattgat
aacgctggcgtcccgatgaagctttataaaacgctggatcgccgcgaagcattgaaagat
gctgatttcgttactacccaactgcgcgttggccaattaccggcgcgtgaactggatgaa
cgtattccattaagtcatggttatcttggtcaggaaaccaacggcgcgggcggtttgttt
aaaggtctgcgtaccattccggtgatttttgacatcgtaaaagatgtcgaagaactttgt
ccgaatgcatgggtgattaacttcactaacccggcgggaatggtcactgaagccgtttat
cgtcataccggatttaaacgctttatcggcgtgtgtaatattccgatcggcatgaagatg
tttattcgcgatgttctgatgctgaaagacagcgatgatttatctatcgatttgttcggc
ctcaaccatatggtgttcattaaggatgtgctgataaatggcaagtcgcgctttgccgaa
ttgcttgatggtgtggcgtcagggcagttaaaagcgtcctctgtaaaaaatattttcgat
ctgccatttagtgagggcttaattcgttcgttgaatctgctgccatgttcttatctgctg
tattacttcaagcagaaagagatgctggctattgaaatgggcgaatactacaaaggcggc
gcacgagcgcaggtagtacagaaagtcgagaaacaactttttgagctgtataaaaatcct
gagctgaaagttaagccgaaagaactggaacagcgcggtggggcttattactctgatgca
gcatgcgaagtgatcaacgctatctacaacgacaagcaagcagaacattacgttaatatc
ccgcatcatgggcagattgataatattccggcagactgggcagtagaaatgacctgtaag
ctggggcgcgatggcgcgacgccacatccgcgcattacgcatttcgatgataaagtaatg
gggctgattcacaccattaaaggcttcgagattgctgccagtaacgccgcacttagcgga
gaatttaacgatgtgttactggcgctaaaccttagtccgttggtgcattccgatcgcgat
gctgagctgctggcacgcgagatgattctggcgcacgagaaatggctgccaaactttgcc
gactgcatcgcagagcttaaaaaagcacattaa
              
                            

Download fasta file
RegulonDB