RegulonDB RegulonDB 10.8: Gene Sequence
creD gene sequence


Size: 1353        A: 315  T: 367  G: 384  C: 287

Fasta

 

>creD E. coli K12. Version NC_000913.3 GI:556503834
atgttgaaatcccccctgttctggaaaatgactagcctgtttggtgcagtattgctgttg
ttgattccgataatgctgattcggcaggtgattgtcgaacgtgctgattaccgtagcgat
gtggaagatgcgattcgccaaagtaccagcgggccgcaaaaactcgttgggccgctcatc
gctattcctgtgaccgagctttatacggtgcaggaagaggataaaaccgtggagcggaaa
cgaagttttatccatttttggttacctgagtcattgatggttgatggcaatcagaacgtg
gaagaacgcaagatagggatttataccggtcaggtctggcacagtgatttaacgttaaaa
gccgatttcgatgtttcgcgtcttagcgaactcaacgcgccaaatatcaccttaggcaag
ccatttattgtgattagcgtcggggatgcgcgtggtattggtgtggtgaaagcgcctgaa
gttaacggaacggcgctgaccattgaacccggcaccgggttagagcaaggcgggcagggc
gtgcatatccctttacctgaaggggactggcggaagcagaacctgaagctgaatatggcc
ctgaatttaagcggtaccggcgatctttctgtggtgcctggcgggcgtaatagcgaaatg
accttaaccagcaactggccgcatcccagttttttaggtgattttctaccagccaaacgg
gaagttagcgagtcaggttttcaggcgcactggcaaagcagctggtttgctaataatctc
ggtgagcgttttgcttcaggcaatgataccggctgggaaaacttcccggcgtttagcgtc
gcagtaacgacgccagccgatcaataccaattaactgaccgggcgactaagtacgccatt
ctgctgattgcactgacttttatggcgttctttgtttttgaaacgctcaccgcgcaacgt
ttacacccaatgcaatatttgctggtggggctttcattggtgatgttttatttgctcttg
ctggcgctttctgaacataccggttttaccgtggcatggataatcgccagtctgattggg
gcgataatgaacggtatttatttgcaagcggtattgaaaggttggtgcaacagcatgttg
tttaccctcgcgctgttgttgctggatggtgtgatgtggggactgctcaactctgccgat
agcgcgctgttgttgggaaccagtgtgctggtggtggcgctggccggcatgatgtttgtg
acccgtaatatcgactggtatgcgttttcactgccgaaaatgaaagccagtaaagaagtt
acaacggacgatgagttacgtatctggaaataa
              
                            

Download fasta file
RegulonDB