RegulonDB RegulonDB 10.9: Gene Sequence
cheZ gene sequence


Size: 645        A: 161  T: 139  G: 189  C: 156

Fasta

 

>cheZ E. coli K12. Version NC_000913.3 GI:556503834
atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgc
atcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggcc
attgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcag
atgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcag
gatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgat
ccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagat
gtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggat
tttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaa
cgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgt
gaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagcc
agtcaggatcaggtggacgatttgttggatagtcttggattttga
              
                            

Download fasta file
RegulonDB