RegulonDB RegulonDB 10.9: Gene Sequence
modC gene sequence


Size: 1059        A: 249  T: 243  G: 314  C: 253

Fasta

 

>modC E. coli K12. Version NC_000913.3 GI:556503834
atgctggaactgaatttttcccagacgttgggcaaccattgcctgactattaatgaaacg
ctgcccgccaatggcatcactgctatctttggcgtctccggtgccggaaaaacttcgctg
attaacgccatcagtggactgacgcgcccgcaaaaagggcggattgtcctcaatgggcgg
gtactaaatgatgccgaaaaaggtatctgcctgacgccggaaaagcgtcgcgttggctat
gtttttcaggatgcgcggctgttcccgcattacaaagtgcgtggcaatctgcgctacggc
atgtcgaaaagtatggtcgatcagttcgataagctggtggcgcttttaggcattgaaccg
ttgcttgaccgtttaccaggcagcctgtccggaggcgaaaaacagcgcgtggcgattggt
cgggctttgctgacagcaccggaattgctgttgctggatgaaccgctggcgtcactggat
attccgcgtaaacgcgaactgttgccttatctgcaacggctgacacgggaaatcaacatt
ccgatgttgtatgtcagccattcgctggatgagatcctccatctggcagacagagtgatg
gtactggaaaacggtcaggtgaaagcctttggcgcgctggaggaagtgtggggcagtagc
gtgatgaatccgtggctgccgaaagagcaacaaagtagcattctgaaagtgacggtgctt
gagcatcatccgcattacgcgatgaccgcgctggcgctgggcgatcagcatttgtgggtc
aataagctggacgaaccgctgcaagctgcgctacgtatccgcattcaggcttccgatgtt
tctctggttttacaaccgccgcagcaaaccagcattcgtaacgtattgcgggcaaaagtt
gttaatagttatgacgacaacggccaggtggaagtggaactggaagtcggcggtaaaacg
ctgtgggcgcgtatcagcccgtgggccagggatgaactggcgatcaaacctggcctgtgg
ctgtacgcgcaaattaaaagtgtgtcgataaccgcctga
              
                            

Download fasta file
RegulonDB