RegulonDB RegulonDB 10.9: Gene Sequence
moeA gene sequence


Size: 1236        A: 256  T: 283  G: 368  C: 329

Fasta

 

>moeA E. coli K12. Version NC_000913.3 GI:556503834
atggaatttaccaccggattgatgtcgctcgacaccgcgcttaatgagatgctttctcgc
gtcaccccactgaccgcccaggaaacgctgccactggtacagtgttttggtcgtattctg
gcgagcgatgtcgtttcgccgcttgatgttccggggtttgataactccgcaatggacggc
tacgcggtgcgtttagccgatattgcctccgggcaaccgctgcccgttgccggtaaatcc
tttgccggtcagccataccatggtgaatggcctgcgggtacctgcattcgtattatgacc
ggtgcgccggtgccggaaggctgcgaagcggtggtgatgcaggagcagactgaacaaatg
gacaatggcgtgcgttttactgctgaagtgcgtagcgggcaaaatattcgccgtcgcggt
gaagatatctctgcaggtgcggttgttttcccggcgggaactcgcctgactaccgcagag
ctgccagtaattgcttcactggggattgccgaagttccggtgattcgtaaagtgcgtgta
gcgcttttttctaccggtgatgaactccagttgcccggtcagccgctgggcgacggccaa
atctacgataccaaccgtctcgccgtacacctgatgttagaacagttgggatgcgaggta
attaacttagggattatccgcgacgatccccatgccctgcgcgccgcatttattgaagcc
gacagccaggcggatgtggtgatcagttccggcggtgtttcagtgggtgaggcggattac
accaaaacgattcttgaagagctgggggagatcgccttctggaagctggcgattaaacca
ggtaaaccgttcgcgttcggtaaactcagcaatagctggttctgcggcctgccgggcaac
ccggtttcagcgacgctgaccttctatcaactggtacagcctttgctggcaaaactaagc
ggtaacaccgccagcggcctgcccgcgcgccagcgcgtacgcacagcgtcccgcctgaaa
aaaacgccaggacgtcttgatttccagcgcggcgtgctgcaacgcaacgccgatggcgaa
ctggaagtgacgaccaccggacatcagggttcacatatatttagctcctttagcctcggc
aactgctttatcgtgctggaacgcgatcgcggcaatgtggaagtgggcgaatgggtggaa
gtagaaccgtttaacgcgttgttcggaggcctgtaa
              
                            

Download fasta file
RegulonDB